Journal of Oral Science & Rehabilitation No. 2, 2016

Journal of Oral Science & Rehabilitation No. 2, 2016

Cover / Editorial / Contents / About the Journal of Oral Science & Rehabilitation / Benefits of publishing in the journal for authors / The role of melatonin in periodontal and periimplant bone homeostasis and regeneration / Three-year clinical and radiographic outcomes of patients treated according to the All-on-4 concept in the daily practice: A prospective observational study on implants and prosthesis survival rates and complications / Accelerated generation of human induced pluripotent stem cells from human oral mucosa using episomal plasmid vectors and maternal transcription factor Glis1 / Bone block graft to treat an apicomarginal defect simultaneously with apical surgery of the maxillary incisors: A case report with three-year follow-up / Composition of platelet-rich plasma gel: A Western blot analysis / Spontaneous bone regeneration after removal of cysts: One-year follow-up of 336 consecutive cases / Knowledge about risk factors associated with periodontal disease among patients referred to a specialist periodontal clinic / Guidelines for authors / Imprint / Subscription form

Open PDF View E-paper Edit Epaper Edit Epaper ads save

Table of contents

) ) [pdf_filetime] => 1729655464 [s3_key] => 68964-95b0bef7 [pdf] => JORS0216.pdf [pdf_location_url] => https://e.dental-tribune.com/tmp/dental-tribune-com/68964/JORS0216.pdf [pdf_location_local] => /var/www/vhosts/e.dental-tribune.com/httpdocs/tmp/dental-tribune-com/68964/JORS0216.pdf [should_regen_pages] => 1 [pdf_url] => https://epaper-dental-tribune.s3.eu-central-1.amazonaws.com/68964-95b0bef7/epaper.pdf [pages_text] => Array ( [1] => JOSR_2_A4.qxp_Layout 1

Journal of

Oral Science
&
Rehabilitation

Volume 2 — Issue 2/2016

ISSN 2365-6123

Journal for periodontology, implant dentistry,
dental prosthodontics and maxillofacial surgery

[2] => JOSR_2_A4.qxp_Layout 1

in a place that has no borders,
creativity goes unbound...

By
S ET TH E VO LU M E
VCONCEPT is a universal approach that takes into consideration an entire structure: The innovative V3
implant, the advanced prosthetic appliance and their affect on a greater volume of bone and soft tissue.
To learn more about VCONCEPT visit: www.vconcept.com

[3] => JOSR_2_A4.qxp_Layout 1

Editorial

Journal of

Oral Science
&
Rehabilitation
For dentists, daily clinical work is as easy as driving a car. Their own
experience provides them with the necessary confidence and skill.
However, the situation changes with the introduction of a new
method or product. In order to gain the requisite skill for performing a new technique, it may be enough to participate in practical
courses. Using a new biomaterial for regeneration or sinus floor
elevation may instead require small changes in technique. However, this may represent a substantial change in biology because
biomaterials do not have the same response during healing and do
not achieve the same results.
When we have doubts about the quality of a new technique or a
new material, we often ask for the opinion of experts and we trust
their advice. It would, however, be better to be already well prepared so that we may gain greater value from consultations with
experts about the issue of interest.
Only through continued updating is it possible to gain the knowledge to help us make independent choices regarding materials and
methods to be used in our daily practice and, indeed, the Journal of
Oral Science & Rehabilitation was born out of a desire to update
clinicians regarding new techniques and materials.
As said above, it is easy to drive a car. However, it may be useful to
know how the car functions and how to fix it when it does not work
properly.
Dr. Daniele Botticelli
Co-editor

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016

[4] => JOSR_2_A4.qxp_Layout 1

Contents

03
Editorial
Dr. Daniele Botticelli
06
About the Journal of Oral Science & Rehabilitation
08
Pablo Galindo Moreno et al.
The role of melatonin in periodontal and periimplant bone homeostasis
and regeneration
16
Marco Tallarico et al.
Three-year clinical and radiographic outcomes of patients treated according to the All-on-4 concept in the daily practice: A prospective observational
study on implants and prosthesis survival rates and complications
26
Takahiro Kashiwagi et al.
Accelerated generation of human induced pluripotent stem cells from
human oral mucosa using episomal plasmid vectors and maternal
transcription factor Glis1
36
Juan Cervera Ballester et al.
Bone block graft to treat an apicomarginal defect simultaneously
with apical surgery of the maxillary incisors: A case report with three-year
follow-up
42
Pablo Galindo Moreno et al.
Composition of platelet-rich plasma gel: A Western blot analysis
50
Marco Di Dio et al.
Spontaneous bone regeneration after removal of cysts: One-year follow-up
of 336 consecutive cases
58
Giovanni Serino et al.
Knowledge about risk factors associated with periodontal disease among
patients referred to a specialist periodontal clinic
64
Guidelines for authors
66
Imprint — about the publisher

04 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[5] => JOSR_2_A4.qxp_Layout 1

[6] => JOSR_2_A4.qxp_Layout 1

About

About
the Journal of Oral Science & Rehabilitation
The aim of the Journal of Oral Science & Rehabilitation is to promote rapid
communication of scientiﬁc information between academia, industry
and dental practitioners, thereby inﬂuencing the decision-making in
clinical practice on an international level.
The Journal of Oral Science & Rehabilitation publishes original and highquality research and clinical papers in the ﬁelds of periodontology, implant dentistry, prosthodontics and maxillofacial surgery. Priority is
given to papers focusing on clinical techniques and with a direct impact
on clinical decision-making and outcomes in the above-mentioned
ﬁelds. Furthermore, book reviews, summaries and abstracts of scientiﬁc
meetings are published in the journal.
Papers submitted to the Journal of Oral Science & Rehabilitation are subject to rigorous double-blind peer review. Papers are initially screened for
relevance to the scope of the journal, as well as for scientiﬁc content and
quality. Once accepted, the manuscript is sent to the relevant associate
editors and reviewers of the journal for peer review. It is then returned to
the author for revision and thereafter submitted for copy editing. The
decision of the editor-in-chief is made after the review process and is
considered ﬁnal.

About
Dental Tribune Science
Dental Tribune Science (DT Science) is an online open-access publishing
platform (www.dtscience.com) on which the Journal of Oral Science &
Rehabilitation is hosted and published.
DT Science is a project of the Dental Tribune International Publishing
Group (DTI). DTI is composed of the leading dental trade publishers
around the world. For more, visit

www.dental-tribune.com

06 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[7] => JOSR_2_A4.qxp_Layout 1

About

Benefits
of publishing in the journal for authors
There are numerous advantages of publishing in the Journal of Oral
Science & Rehabilitation:
– Accepted papers are published in print and as e-papers on
www.dtscience.com.
– Authors’ work is granted exposure to a wide readership, ensuring
increased impact of their research through open-access publishing on
www.dtscience.com.
– Authors have the opportunity to present and promote their
research by way of interviews and articles published on both
www.dtscience.com and www.dental-tribune.com.
– Authors can also post videos relating to their research, present
a webinar and blog on www.dtscience.com.

Subscription price
€50.00 per issue, including VAT and shipping costs.

Information for subscribers
The journal is published quarterly. Each issue is published as both a print
version and an e-paper on www.dtscience.com.

Terms of delivery
The subscription price includes delivery of print journals to the recipient’s
address. The terms of delivery are delivered at place (DAP); the recipient
is responsible for any import duty or taxes.

Copyright © 2016 Dental Tribune International GmbH. Published by
Dental Tribune International GmbH. All rights reserved. No part of this
publication may be reproduced, stored or transmitted in any form or by
any means without prior permission in writing from the copyright holder.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016

07

[8] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

The role of melatonin
in periodontal and periimplant
bone homeostasis and
regeneration

Abstract
Background
Pablo Galindo Moreno,a Gustavo Avila Ortiz,b Hom-Lay
Wang,c Miguel Padial Molina,a Inmaculada Ortega Olleraa
& Francisco O’Valled
a

Department of Oral Surgery and Implant Dentistry,
School of Dentistry, University of Granada, Granada,
Spain
b
Department of Periodontics, College of Dentistry,
University of Iowa, Iowa City, Iowa, U.S.
c
Department of Periodontics and Oral Medicine, School
of Dentistry, University of Michigan, Ann Arbor, Mich., U.S.
d
Pathology Department, School of Medicine, and Institute
of Biopathology and Regenerative Medicine, University
of Granada, Granada, Spain

Melatonin, a hormone produced primarily in the pineal gland, possesses
a series of biological properties that appear to have an inﬂuence on bone
homeostasis. Currently, little is known about how melatonin inﬂuences
bone metabolism in periodontology and implantology.
Objectives

The objectives of this study are (1) to review the properties of melatonin
in regulating bone homeostasis; (2) to discuss its direct and indirect effects
on bone; and (3) to propose mechanisms for the use of melatonin as an
agent to promote alveolar bone regeneration.

Corresponding author:

Conclusion

Dr. Pablo Galindo Moreno

Melatonin positive regulation of bone formation and homeostasis, in combination with the inhibitory effects on bone resorption, highlights the
potential use of melatonin as a marker of periodontal and periimplant
bone-related diseases. In vitro and animal studies show promising results
on the use of melatonin as a regenerative agent, although no clinical studies have yet been performed.

C/ Recogidas, 39 5º Izq
18005 Granada
Spain
T +34 958 52 0658
F +34 958 52 0658
pgalindo@ugr.es

Keywords

How to cite this article:
How to cite this article: Galindo Moreno P, Avila Ortiz G,
Wang HL, Padial Molina M, Ortega Oller I, O’Valle F.
The role of melatonin in periodontal and periimplant bone
homeostasis and regeneration.

Melatonin, osteoblasts, osteoclasts, periodontal disease, dental implant,
free radicals.

J Oral Science Rehabilitation.
2016 Jun;2(2):8–15.

8 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[9] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

Introduction
Numerous systemic hormonal changes are
known to be associated with aging.1 Some conditions linked to circadian rhythms and age may
alter bone metabolism, resulting in changes in
immune activity or bone-associated pathologies,2
such as periodontal disease. These disorders may
be associated with alterations in normal levels of
melatonin.3, 4
Melatonin (N-acetyl-5-methoxytryptamine),
a hormone that is endogenously synthesized,
primarily in the pineal gland, is a molecule with
intense antioxidant activity5 and a wide range of
biological actions, notably in the control of metabolism and bone development.6 Melatonin is
currently used in therapies as a coadjuvant in
cancer therapy,7 for anti-aging,8 as an immunostimulatory agent9 or as a sleep regulator,10 as
well as to increase bone density in menopausal
patients11 (Fig. 1). It is reported that salivary melatonin is released by the acinar cells of the major
salivary glands and the gingival crevicular ﬂuid.
It follows a circadian rhythm, with the highest
values at night. Moreover, in the oral cavity, melatonin can act both by receptor-mediated and
by receptor-independent pathways.12 Therefore,
through complex molecular pathways that have
gained special interest for the research community in periodontology, it may play a role in alveolar periodontal and periimplant bone maintenance and regeneration.
Melatonin is an amphiphilic molecule that is
able to cross most biological barriers. It can exert
its effect by binding to G-protein-coupled membrane receptors (MT1 and MT2) or by penetrating
the cell through a speciﬁc family of transmembrane channels,13 subsequently initiating a nuclear or cytoplasmic molecular cascade. When it
reaches the nuclei, melatonin binds to a subfamily
of nuclear receptors key in regulating bone metabolism, the RZR (retinoid Z receptor)/ROR (retinoid orphan receptor) receptor.14 It then regulates a number of cellular events, such as
promotion of mitosis, induction of DNA repair,15
or cell differentiation and proliferation.16
Interestingly, it is known that melatonin can
be synthesized in the bone marrow, where its
concentration is around 100-fold higher than in
serum.17 Furthermore, melatonin in the bone marrow protects its cells against cytotoxic agents
in vivo.18 However, the specific biochemical
mechanisms that regulate this modulation, speciﬁcally in alveolar bone in humans, are current-

ly not fully understood.11 Hence, it is the purpose
of this review to describe the properties of melatonin in regulating bone homeostasis, directly
and indirectly, as well as to analyze different therapeutic strategies for the use of melatonin as an
agent to promote periodontal and periimplant
bone maintenance and regeneration (Fig. 2).

Direct effects on bone
I. Melatonin and bone formation

The major organic component of bone extracellular matrix is Type I collagen, which supports the
expression of bone cell phenotypes and enhances mineralization. Melatonin has been
shown to regulate the synthesis of Type I collagen
as a preliminary step to the expression of other
bone-related proteins, such as bone sialoprotein,
alkaline phosphatase and osteocalcin, during
osteoblastic maturation.16
Bone sialoprotein (BSP) is referred to as a
marker of the late stage of osteoblastic differentiation. BSP is expressed during osteoblastic cell
differentiation in the extracellular matrix, where
it is essential for osteoblast attachment and bone
mineralization. Within this context, it has been
reported that MC3T3 pre-osteoblast cells matured in 12 days in the presence of melatonin
compared with 21 days without melatonin. Gene
expression of BSP and related proteins of osteoblastic differentiation (e.g., osteocalcin, alkaline
phosphatase) is also accelerated and increased
in melatonin-treated compared with nontreated
cells.19 Furthermore, by inhibiting the interaction
of BSP with osteoblastic cell lines, the activity of
alkaline phosphatase, osteocalcin synthesis and
cellular response to parathyroid hormone (PTH)
are also inhibited20 and, subsequently, osteoblast
differentiation is impaired.21 Thus, these ﬁndings
suggest that melatonin may have an effect in
regulating osteoblast proliferation and differentiation. These effects could lead to beneﬁcial
effects in the treatment of pathological processes
associated with bone resorption or destruction
by mediating not only in the expression of BSP
but of other bone glycoproteins as well, resulting
in enhanced bone apposition.
II. Melatonin and bone resorption

Melatonin also exerts an important direct biological action on the osteoclast, another key cell in

Journal of
Oral Science & Rehabilitation

9 Volume 2 | Issue 2/2016

[10] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

Fig. 1

Pineal gland

Secretion

Melatonin

ANTIOXIDANT
AGENT

BIOLOGICAL
ACTIONS

Scavenging of free
radicals

Immunostimulatory
agent
Anti-carcinogenic

NEUTRALIZED

Sleep regulator

Peroxyl radical

Fig. 1
Melatonin properties.

BONE
METABOLISM

Hydroxyl radical

bone turnover. The biological activity of osteoclasts is bone resorption, initiated by attachment
to the surface of the bone tissue and secreting
protons and free radicals into the cell compartment formed below their ruffled border. The activity of osteoclasts is essentially regulated by
the molecular triad osteoprotegerin/receptor
activator of nuclear factor-kappa B/receptor activator of nuclear factor-kappa-B ligand (OPG/
RANK/RANKL). The balance and expression of
this triad in bone tissue decisively inﬂuence differentiation and activation of osteoclasts and play
an important role in coordinating osteogenesis,
odontogenesis and tooth eruption. The proteins
of this triad can be synthesized by a large number
of cells, including bone marrow cells, dendritic
cells, lymphoid cells and endothelial cells. Osteoblasts are the key cell type in the secretion of OPG
and RANKL and, therefore, orchestrate the bone
turnover. Changes in the expression balance of
this triad can be responsible for hereditary bone
disorders, such as familiar expansile osteolysis,
10 Volume 2 | Issue 2/2016

expansile skeletal hyperphosphatasia and juvenile Paget’s disease; different forms of osteoporosis; and other metabolic bone diseases.
The OPG/RANK/RANKL triad can be modulated by numerous molecules, including melatonin.22 Melatonin suppresses osteoclastic and
osteoblastic activity by interacting with this
triad.23 It reduces the expression of RANK in osteoblasts24 and RANK receptor in osteoclasts19
while increasing OPG,24 eventually preventing
the appearance and activation of osteoclasts.19
This suggests that melatonin in pharmacological
doses can inhibit bone resorption and increase
bone mass by down-regulating RANK-mediated
osteoclast proliferation and activation.24
Another important aspect of the relationship
between osteoclasts and melatonin concerns the
production of free radicals by osteoclasts during
osteolysis. Osteoclasts generate high levels of
superoxide anions during bone resorption that
contribute to the degenerative process of the
organic bone matrix. One of the most important

Journal of
Oral Science & Rehabilitation

[11] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

Fig. 2

MELATONIN
Influence on bone homeostasis

Direct effects
OSTEOBLASTS

Indirect effects

OSTEOCLASTS

OTHER CELLS

P/Ca2+ BALANCE
Estrogen/Calcitonin
PTH/Glucocorticoids
Twist-1 and -2 gene expression

Increases secretion of Type I
collagen
Increases expression of BSP
and other markers (ALP, OC)

Downregulation of
resorptive activity by
modulating the balance
of RANK/RANKL/OPG
Scavenging of free
radicals secreted by
osteoclasts in the
resorptive process

Fibroblasts

IMMUNE SYSTEM

Increases proliferation
and collagen synthesis
Immune cells
Stimulates secretion of
cytokines (IL-2, IL-6)

Decreases inflammatory
acute reaction
FREE RADICALS
Scavenger
+
Antioxidant

mechanisms underlying this resorption involves
the protective superoxide-scavenging enzyme
superoxide dismutase. Melatonin is a signiﬁcant
free-radical scavenger and antioxidant at both
physiological and pharmacological concentrations.6 Beside its ability to directly neutralize a
number of free radicals and reactive oxygen and
nitrogen species, melatonin stimulates several
antioxidative enzymes,19, 25 limiting the resorptive
osteoclast activity.

Indirect effects on bone
I. Relationship with hormones
and genes involved in bone turnover

Melatonin is an important modulator of calcium
and phosphorus metabolism.26 In addition to its
direct actions on cells that modulate bone homeostasis, melatonin may exert its effects indirectly on the bone system by inﬂuencing the

activity of important regulators of the phosphorus–calcium balance and bone metabolism.
Many studies have indicated that melatonin may
inﬂuence the release of several factors that affect
bone, such as calcitonin, 27 corticosterone, 28
growth factors29 and immunological factors.30
– Calcitonin, together with bisphosphonates and
estrogens, is an important regulator of the
apoptosis of osteoclasts. It is a powerful inhibitor of osteoclastic resorptive activity by promoting the reduction of contact between osteoclasts and the bone surface, altering the
morphology of osteoclasts and decreasing their
mobility. Melatonin increases secretion of calcitonin in rats, and this may inhibit bone resorption.31
– PTH increases the expression of RANKL and
decreases the expression of OPG. Melatonin
decreases the levels of PTH, and this may, indirectly, generate an increase in bone mineralization.32

Journal of
Oral Science & Rehabilitation

11 Volume 2 | Issue 2/2016

Fig. 2
Effects of melatonin on bone.
ALP: alkaline phosphatase;
OC: osteocalcin.

[12] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

– Cortisol (also known as hydrocortisone) and
other glucocorticoids are increased when melatonin is reduced. They are responsible for inhibiting bone formation through direct actions
on osteoblasts by blocking their recruitment
and differentiation, and subsequently inhibiting
the production of Type I collagen. An increase
in cortisol is also responsible for an increase in
bone resorption via antagonism of the 1,25dihydroxyvitamin D. Therefore, as melatonin
increases, glucocorticoids are reduced and their
pro-resorptive effects are limited.
– Melatonin also stimulates estrogen secretion
and, therefore, limits the associated deleterious
effects of deﬁciency.33
II. Action in immune system

The role played by melatonin in the immune system is well documented.34 The effects of melatonin have been most widely studied in the context of depressed immune systems with the aim
of improving immunodeﬁciency situations. Melatonin regulates the apoptosis of B and T cells
and has been reported to accelerate the production of leukocytes.35
In addition to the direct effect on cells of the immune system, melatonin reduces the synthesis
of prostaglandins, especially PGE-2; prevents the
translocation of nuclear factor-kappa B to the
nucleus and its binding to DNA, thereby reducing
the up-regulation of a variety of pro-inﬂammatory cytokines;36 inhibits the production of adhesion molecules that promotes the adhesion of
leukocytes to endothelial cells;37 and attenuates
transendothelial cell migration and edema, which
contribute to tissue damage.30 It also stimulates
the release of interleukin-2 in Jurkat cells38 and
interleukin-6 in peripheral blood mononuclear
cells,39 while it inhibits the inﬂammatory enzyme
cyclooxygenase-2 (COX-2) and binds to the active
sites of COX-1 and COX-2.40 Therefore, melatonin
can inhibit acute inﬂammatory reaction and contribute to generating an immune reaction, minimizing the associated bone loss.30
III. Action on free radicals

One of the principal biological actions of melatonin
is its wide antioxidant spectrum and powerful endogenous effect as a free-radical scavenger.41
Thus, it has an indirect reparative effect and prevents intracellular damage, protecting cells from
free radicals and chemical substances. Melatonin
12 Volume 2 | Issue 2/2016

acts on oxygen- and nitrogen-derived free radicals,
including the highly toxic hydroxyl radical,42 peroxynitrite anion43 and hypochlorous acid.44 In addition to directly neutralizing free radicals and
reactive species of nitrogen and oxygen, melatonin
stimulates other antioxidant enzymes, such as
glutathione.45
At the bone level, these effects are of vital
importance because osteoclasts secrete a wide
variety of molecular agents for bone degradation.
Free radicals are the highly secreted ones. Osteoclasts generate superoxide anions during resorption that contribute to the degradative processes of the organic bone matrix. Other cell
types, such as monocytes, macrophages and
neutrophils, accumulate on the adjacent surfaces
of the bone in chronic inﬂammatory processes.
These cells have the capacity to produce free
radicals and, as previously mentioned, are able
to stimulate osteoclastic response by liberating
mediators (cytokines, tumor necrosis factors,
etc.). Therefore, the use of anti-free-radical
agents might be an adequate alternative therapy
for these types of pathologies, by limiting osteoclastic activation or free-radical production.

Melatonin and periodontal disease
Periodontal disease is caused by a bacterial challenge that triggers an inﬂammatory reaction in a
susceptible host. Alterations in the OPG/RANK/
RANKL complex, among other cytokines and local factors, have been linked to an increase in the
periodontal destruction, mediated by the increase
in RANKL production by inflammatory cells,
mainly macrophages, and the decrease of OPG.
Additionally, the periodontal tissue is affected by
the free radicals that burst from phagocytic cells,
such as neutrophils and macrophages, which
signiﬁcantly damage the gingival tissue.
In view of these common factors and targets,
it is reasonable to expect an association between
periodontal disease and levels of melatonin.46
Several clinical studies have demonstrated it.3, 4, 47
These studies showed that levels of melatonin in
serum, saliva, gingival crevicular ﬂuid or all three
are inversely associated with the severity of the
disease, which indicates that melatonin may have
a protective role against periodontal disease.
Moreover, the effects of melatonin on the
reduction of osteoclastogenesis, the capture of
reactive oxygen species and their metabolites in
the inﬂamed area, the increase in bone minera-

Journal of
Oral Science & Rehabilitation

[13] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

lization through the increase in proliferation, differentiation and activity of osteoblasts, and collagen and BSP regulation, as already explained,
together with its anti-ﬁbrotic and anti-inﬂammatory effects on gingival tissue by a reduction
of the matrix metalloproteinase-1/tissue inhibitor
of metalloproteinases-1 ratio, suggest the possibility of using melatonin as a host-modulating
agent in the treatment and control of periodontal
disease, improving the bone tissue conditions
and the soft-tissue stability.48 The in vivo administration of local or systemic melatonin could,
therefore, be indicated in these patients, although
no studies have yet been performed in this sense
with validated methods.

Melatonin and dental implants
Dental implants are commonly used in current
treatment of tooth loss. However, to avoid potential early complications and implant failures,49, 50
bone healing must occur in the proper way. Bone
remodeling around dental implants is highly inﬂuenced by the implant surface characteristics
and evolves as a balance between the activity of
osteoblasts and osteoclasts.51, 52 Therefore, the
use of melatonin as a topical agent to induce biomimetic properties of the implant surface has
emerged as a promising technique.53 Melatonin
directly inﬂuences the osteoblast’s response to
the implant surface and osseointegration. The
addition of melatonin improves results for cell
adhesion, proliferation and differentiation on different titanium surface modiﬁcations at early
time points, although longer culturing times
seem to reduce those differences.54
These effects have been conﬁrmed in vivo in
several studies.55, 56 The effects around dental
implants are similar to those that take place in
bone repair. Bone repair consists, biologically, of
three different stages: inﬂammatory, proliferative and remodeling. Melatonin may play a role
in these phases owing to its regulatory effects
on inﬂammation, antioxidant properties, regulation of bone cells, and stimulation of collagen
synthesis and deposition. Moreover, melatonin
has been shown to increase the number of blood
vessels, which is a prerequisite for the supply of
mineral elements and the migration of angiogenic and osteogenic cells. As a consequence, histological evaluation of the periimplant bone
shows more trabecular bone, but less cortical
bone and higher bone-to-implant contact in

melatonin-treated sockets compared with controls.55 Therefore, the use of melatonin for osseointegration might be of interest as a biomimetic
agent. Moreover, it has been suggested to induce
bone growth when applied in combination with
bone grafts.56 However, its potential use in regenerating post-periimplantitis defects has not
been studied yet.

Conclusion
Melatonin positive regulation of bone formation
and homeostasis, in combination with the inhibitory effects on bone resorption, highlights the
potential use of melatonin as a marker of periodontal and periimplant bone-related diseases.
Moreover, in vitro and animal studies are starting
to show promising results on its use as a regenerative agent, although no clinical studies have
yet been performed. This new strategy may create possibilities for novel therapies in the treatment of periodontal disease or enhancing the
outcomes of implant dentistry.

Competing interests
The authors declare that they have no conﬂict of
interests related to this study.

Acknowledgments
The authors would like to thank Mr. Chris Jung
for the original images presented in this review.
MPM received funding from the Talentia Fellowship Program (Regional Government of Andalusia, Spain). The authors have been partially supported by Research Groups No. CTS-138 and
No. CTS-583 (Regional Government of Andalusia) and by the Andalucía Talent Hub Fellowship
Program (European Union’s Seventh Framework
Programme, Marie Skłodowska-Curie actions,
COFUND, grant agreement No. 291780; and
Regional Government of Andalusia).

Journal of
Oral Science & Rehabilitation

13 Volume 2 | Issue 2/2016

[14] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

References
1.
Morley JE. Hormones and the aging
process.
→ J Am Geriatr Soc.
2003 Jul;51(7 Suppl):S333–7.

8.
Poeggeler B. Melatonin, aging, and
age-related diseases: perspectives for
prevention, intervention, and therapy.
→ Endocrine.
2005 Jul;27(2):201–12.

2.
Eastell R, Calvo MS, Burritt MF, Offord KP,
Russell RG, Riggs BL. Abnormalities in
circadian patterns of bone resorption and
renal calcium conservation in type I
osteoporosis.
→ J Clin Endocrinol Metab.
1992 Mar;74(3):487–94.

9.
Maestroni GJ. MLT and the immunehematopoietic system. In: Olcese J, editor.
Melatonin after four decades: an
assessment of its potential.
→ New York: Springer;
1999. p. 395–405. (Advances in
Experimental Medicine and Biology; vol.
460).

3.
Cutando A, Galindo P, Gómez-Moreno G,
Arana C, Bolaños J, Acuña-Castroviejo D,
Wang HL. Relationship between salivary
melatonin and severity of periodontal
disease.
→ J Periodontol.
2006 Sep;77(9):1533–8.

10.
Buscemi N, Vandermeer B, Pandya R,
Hooton N, Tjosvold L, Hartling L, Baker G,
Vohra S, Klassen T. Melatonin for
treatment of sleep disorders.
→ Evid Rep Technol Assess (Summ).
2004 Nov;(108):1–7.

4.
Gómez-Moreno G, Cutando-Soriano A,
Arana C, Galindo P, Bolaños J, Acuña-Castroviejo D, Wang HL. Melatonin expression
in periodontal disease.
→ J Periodontal Res.
2007 Dec;42(6):536–40.
5.
Reiter RJ, Tan DX, Poeggeler B,
Menendez-Pelaez A, Chen LD, Saarela S.
Melatonin as a free radical scavenger:
implications for aging and age-related
diseases.
→ Ann N Y Acad Sci.
1994 May;719:1–12.
6.
Liu J, Huang F, He HW. Melatonin effects
on hard tissues: bone and tooth.
→ Int J Mol Sci.
2013 May;14(5):10063–74.
7.
Rapozzi V, Zorzet S, Comelli M, Mavelli I,
Perissin L, Giraldi T. Melatonin decreases
bone marrow and lymphatic toxicity of
adriamycin in mice bearing TLX5
lymphoma.
→ Life Sci.
1998 Oct;63(19):1701–13.

11.
Ostrowska Z, Kos-Kudla B, Marek B,
Swietochowska E, Górski J. Assessment of
the relationship between circadian
variations of salivary melatonin levels and
type I collagen metabolism in postmenopausal obese women.
→ Neuro Endocrinol Lett.
2001 Apr;22(2):121–7.
12.
Reiter RJ, Rosales-Corral SA, Liu XY,
Acuna-Castroviejo D, Escames G, Tan DX.
Melatonin in the oral cavity: physiological
and pathological implications.
→ J Periodontal Res.
2015 Feb;50(1):9–17.
13.
Reppert SM, Weaver DR, Godson C.
Melatonin receptors step into the light:
cloning and classiﬁcation of subtypes.
→ Trends Pharmacol Sci.
1996 Mar;17(3):100–2.
14.
Meyer T, Kneissel M, Mariani J, Fournier B.
In vitro and in vivo evidence for orphan
nuclear receptor RORʸ function in bone
metabolism.
→ Proc Natl Acad Sci U S A.
2000 Aug;97(16):9197–202.
15.
Tan D, Reiter RJ, Chen LD, Poeggeler B,
Manchester LC, Barlow-Walden LR. Both
physiological and pharmacological levels of
melatonin reduce DNA adduct formation
induced by the carcinogen safrole.
→ Carcinogenesis.
1994 Feb;15(2):215–8.

17.
Tan DX, Manchester LC, Reiter RJ, Qi WB,
Zhang M, Weintraub ST, Cabrera J, Sainz
RM, Mayo JC. Identiﬁcation of highly
elevated levels of melatonin in bone
marrow: its origin and signiﬁcance.
→ Biochim Biophys Acta.
1999 Oct;1472(1-2):206–14.
18.
Anwar MM, Mahfouz HA, Sayed AS.
Potential protective effects of melatonin on
bone marrow of rats exposed to cytotoxic
drugs.
→ Comp Biochem Physiol A Mol Integr
Physiol.
1998 Feb;119(2):493–501.

25.
Ladizesky MG, Boggio V, Albornoz LE,
Castrillón PO, Mautalen C, Cardinali DP.
Melatonin increases oestradiol-induced
bone formation in ovariectomized rats.
→ J Pineal Res.
2003 Mar;34(2):143–51.

19.
Cardinali DP, Ladizesky MG, Boggio V,
Cutrera RA, Mautalen C. Melatonin effects
on bone: experimental facts and clinical
perspectives.
→ J Pineal Res.
2003 Mar;34(2):81–7.

26.
Ladizesky MG, Cutrera RA, Boggio V,
Somoza J, Centrella JM, Mautalen C,
Cardinali DP. Effect of melatonin on bone
metabolism in ovariectomized rats.
→ Life Sci.
2001 Dec;70(5):557–65.

20.
Mizuno M, Imai T, Fujisawa R, Tani H,
Kuboki Y. Bone sialoprotein (BSP) is a
crucial factor for the expression of
osteoblastic phenotypes of bone marrow
cells cultured on type I collagen matrix.
→ Calcif Tissue Int.
2000 May;66(5):388–96.

27.
Turgut M, Uslu S, Uysal A, Yurtseven ME,
Ustün H. Changes in vascularity of
cartilage endplate of degenerated
intervertebral discs in response to
melatonin administration in rats.
→ Neurosurg Rev.
2003 May;26(2):133–8.

21.
Cooper LF, Yliheikkilä PK, Felton DA,
Whitson SW. Spatiotemporal assessment
of fetal bovine osteoblast culture
differentiation indicates a role for BSP in
promoting differentiation.
→ J Bone Miner Res.
1998 Apr;13(4):620–32.

28.
Hakanson DO, Bergstrom WH. Pineal and
adrenal effects on calcium homeostasis in
the rat.
→ Pediatr Res.
1990 Jun;27(6):571–3.

22.
Theoleyre S, Wittrant Y, Tat SK, Fortun Y,
Redini F, Heymann D. The molecular triad
OPG/RANK/RANKL: involvement in the
orchestration of pathophysiological bone
remodeling.
→ Cytokine Growth Factor Rev.
2004 Dec;15(6):457–75.
23.
Suzuki N, Hattori A. Melatonin suppresses
osteoclastic and osteoblastic activities in
the scales of goldﬁsh.
→ J Pineal Res.
2002 Nov;33(4):253–8.

16.
Nakade O, Koyama H, Ariji H, Yajima A,
Kaku T. Melatonin stimulates proliferation
and type I collagen synthesis in human
bone cells in vitro.
→ J Pineal Res.
1999 Sep;27(2):106–10.

14 Volume 2 | Issue 2/2016

24.
Koyama H, Nakade O, Takada Y, Kaku T,
Lau KH. Melatonin at pharmacologic doses
increases bone mass by suppressing
resorption through down-regulation of the
RANKL-mediated osteoclast formation and
activation.
→ J Bone Miner Res.
2002 Jul;17(7):1219–29.

Journal of
Oral Science & Rehabilitation

29.
Ostrowska Z, Kos-Kudla B, Marek B,
Kajdaniuk D. Inﬂuence of lighting
conditions on daily rhythm of bone
metabolism in rats and possible
involvement of melatonin and other
hormones in this process.
→ Endocr Regul.
2003 Sep;37(3):163–74.
30.
Reiter RJ, Calvo JR, Karbownik M, Qi W,
Tan DX. Melatonin and its relation to the
immune system and inﬂammation.
→ Ann N Y Acad Sci.
2000 Jan;917:376–86.
31.
Ostrowska Z, Kos-Kudla B, Marek B,
Kajdaniuk D, Ciesielska-Kopacz N. The
relationship between the daily proﬁle of
chosen biochemical markers of bone
metabolism and melatonin and other
hormone secretion in rats under
physiological conditions.
→ Neuro Endocrinol Lett.
2002 Oct-Dec;23(5-6):417–25.

[15] => JOSR_2_A4.qxp_Layout 1

Effects of melatonin on bone

32.
Sandyk R, Anastasiadis PG, Anninos PA,
Tsagas N. Is postmenopausal osteoporosis
related to pineal gland functions?
→ Int J Neurosci.
1992 Feb;62(3-4):215–25.

40.
De la Rocha N, Rotelli A, Aguilar CF, Pelzer
L. Structural basis of the anti-inﬂammatory
activity of melatonin.
→ Arzneimittelforschung.
2007;57(12):782–6.

33.
Okatani Y, Morioka N, Wakatsuki A.
Changes in nocturnal melatonin secretion
in perimenopausal women: correlation
with endogenous estrogen concentrations.
→ J Pineal Res.
2000 Mar;28(2):111–8.

41.
Reiter RJ, Tan DX, Mayo JC, Sainz RM,
Leon J, Czarnocki Z. Melatonin as an
antioxidant: biochemical mechanisms and
pathophysiological implications in humans.
→ Acta Biochim Pol.
2003 Jan;50(4):1129–46.

34.
Carrillo-Vico A, Guerrero JM, Lardone PJ,
Reiter RJ. A review of the multiple actions
of melatonin on the immune system.
→ Endocrine.
2005 Jul;27(2):189–200.

42.
Stasica P, Ulanski P, Rosiak JM. Melatonin
as a hydroxyl radical scavenger.
→ J Pineal Res.
1998 Aug;25(1):65–6.

35.
Guerrero JM, Reiter RJ. Melatoninimmune system relationships.
→ Curr Top Med Chem.
2002 Feb;2(2):167–79.
36.
Mohan N, Sadeghi K, Reiter RJ, Meltz ML.
The neurohormone melatonin inhibits
cytokine, mitogen and ionizing radiation
induced NF-kappa B.
→ Biochem Mol Biol Int.
1995 Dec;37(6):1063–70.
37.
Bertuglia S, Marchiafava PL, Colantuoni A.
Melatonin prevents ischemia reperfusion
injury in hamster cheek pouch microcirculation.
→ Cardiovasc Res.
1996 Jun;31(6):947–52.
38.
Guerrero JM, Pozo D, García-Mauriño S,
Osuna C, Molinero P, Calvo JR.
Involvement of nuclear receptors in the
enhanced IL-2 production by melatonin in
Jurkat cells.
→ Ann N Y Acad Sci.
2000 Jan;917:397–403.
39.
Garcia-Mauriño S, Gonzalez-Haba MG,
Calvo JR, Goberna R, Guerrero JM.
Involvement of nuclear binding sites for
melatonin in the regulation of IL-2 and IL-6
production by human blood mononuclear
cells.
→ J Neuroimmunol.
1998 Dec;92(1-2):76–84.

43.
Gilad E, Cuzzocrea S, Zingarelli B, Salzman
AL, Szabó C. Melatonin is a scavenger of
peroxynitrite.
→ Life Sci.
1997 Jan;60(10):PL169–74.
44.
Marshall KA, Reiter RJ, Poeggeler B,
Aruoma OI, Halliwell B. Evaluation of the
antioxidant activity of melatonin in vitro.
→ Free Radic Biol Med.
1996 Dec;21(3):307–15.
45.
Chapple IL. Reactive oxygen species and
antioxidants in inﬂammatory diseases.
→ J Clin Periodontol.
1997 May;24(5):287–96.
46.
Cengiz Mİ, Cengiz S, Wang HL. Melatonin
and oral cavity.
→ Int J Dent [Internet].
2012 Jun 25 [cited 2016 May 4];2012:Article 491872 [9 p.]. Available from:
downloads.hindawi.com/journals/
ijd/2012/491872.pdf
doi:10.1155/2012/491872.
47.
Srinath R, Acharya AB, Thakur SL. Salivary
and gingival crevicular ﬂuid melatonin in
periodontal health and disease.
→ J Periodontol.
2010 Feb;81(2):277–83.
48.
Gómez-Florit M, Ramis JM, Monjo M.
Anti-ﬁbrotic and anti-inﬂammatory
properties of melatonin on human gingival
ﬁbroblasts in vitro.
→ Biochem Pharmacol.
2013 Dec;86(12):1784–90.

50.
Galindo-Moreno P, Padial-Molina M,
Sánchez-Fernández E, Hernández-Cortés
P, Wang HL, O’Valle F. Dental implant
migration in grafted maxillary sinus.
→ Implant Dent.
2011 Dec;20(6):400–5.
51.
Padial-Molina M, Galindo-Moreno P,
Fernández-Barbero JE, O’Valle F,
Jódar-Reyes AB, Ortega-Vinuesa JL,
Ramón-Torregrosa PJ. Role of wettability
and nanoroughness on interactions
between osteoblast and modiﬁed silicon
surfaces.
→ Acta Biomater.
2011 Feb;7(2):771–8.
52.
Padial-Molina M, Galindo-Moreno P,
Avila-Ortiz G. Biomimetic ceramics in
implant dentistry.
→ Minerva Biotecnol.
2009 Sep;21(3):173–86.
53.
Gómez-Moreno G, Aguilar-Salvatierra A,
Boquete-Castro A, Guardia J, Piattelli A,
Perrotti V, Delgado-Ruiz RA, Calvo-Guirado
JL. Outcomes of topical applications of
melatonin in implant dentistry:
a systematic review.
→ Implant Dent.
2015 Feb;24(1):25–30.
54.
Solá-Ruiz MF, Pérez-Martínez C,
Martín-del-Llano JJ, Carda-Batalla C,
Labaig-Rueda C. In vitro preliminary study
of osteoblast response to surface
roughness of titanium discs and topical
application of melatonin.
→ Med Oral Patol Oral Cir Bucal.
2015 Jan;20(1):e88–93.
55.
Tresguerres IF, Clemente C, Blanco L,
Khraisat A, Tamimi F, Tresguerres JA.
Effects of local melatonin application on
implant osseointegration.
→ Clin Implant Dent Relat Res.
2012 Jun;14(3):395–9.
56.
Calvo-Guirado JL, Gómez-Moreno G,
Maté-Sánchez JE, López-Marí L,
Delgado-Ruiz R, Romanos GE. New bone
formation in bone defects after melatonin
and porcine bone grafts: experimental
study in rabbits.
→ Clin Oral Implants Res.
2015 Apr;26(4):399–406.

49.
Galindo-Moreno P, Padial-Molina M, Avila
G, Rios HF, Hernández-Cortés P, Wang HL.
Complications associated with implant
migration into the maxillary sinus cavity.
→ Clin Oral Implants Res.
2012 Oct;23(10):1152–60.

Journal of
Oral Science & Rehabilitation

15 Volume 2 | Issue 2/2016

[16] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Three-year clinical and radiographic
outcomes of patients treated according
to the All-on-4 concept in the daily
practice: A prospective observational
study on implants and prosthesis
survival rates and complications

Abstract
Objective
Marco Tallarico,a Silvio Mario Meloni,b Erta Xhanaric
& Luigi Canullod
a

Private practice, Rome, Italy
& University of Sassari, Sassari, Italy
b
University of Sassari, Sassari, Italy
c
Independent researcher, Tirana, Albania
d
Independent researcher, Rome, Italy

All-on-4 treatment concept is widely applied for complete-arch rehabilitations. Nevertheless, minor technical and biological complications can
occur. The objective of this study was to evaluate the three-year clinical
and radiographic data of complete-arch ﬁxed dental prostheses supported by four implants according to the All-on-4 protocol.
Materials and methods

Corresponding author:
Dr. Marco Tallarico
Via di Val Tellina 116
00151 Rome
Italy
M +39 3280758769
me@studiomarcotallarico.it
How to cite this article:
Tallarico M, Meloni MS, Xhanari E, Canullo L. Three-year
clinical and radiographic outcomes of patients treated
according to the All-on-4 concept in the daily practice: a
prospective observational study on implants and prosthesis
survival rates and complications.
J Oral Science Rehabilitation.
2016 Jun;2(2):16–25.

Thirty consecutive edentulous patients or patients with terminal dentition
(18 females and 12 males; mean age of 67.4 years), with a preference for
implant-supported complete-arch screw-retained ﬁxed dental prostheses,
were enrolled and treated according to the All-on-4 protocol between
January 2008 and December 2011. The outcomes evaluated were implant
and prosthesis survival and success rates, any technical and biological
complications, periimplant marginal bone loss and patient satisfaction.
Results

One hundred and twenty regular platform implants were placed. No patients dropped out. One implant failed two months after placement, resulting in a cumulative implant survival rate of 99.2%. No deﬁnitive prostheses failed. Eight technical and three biological complications were
reported in 11 patients during the entire follow-up period. At the three-year
examination, the mean marginal bone loss was 1.52 ± 0.41 mm.
Conclusion

Within the limitations of the present study, the All-on-4 protocol was
deemed a viable treatment concept for the complete-arch rehabilitation of
both jaws in the medium term. Further long-term prospective studies are
needed to conﬁrm these results.
16 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[17] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Introduction

Materials and methods

Complete edentulism is associated with decreased masticatory function, as well as unfavorable esthetics due to the loss of support for the
facial musculature, decreased vertical dimension
and speech impairment.1–3 The conventional
method for treating edentulous patients is to rehabilitate them with a complete removable denture. However, the denture must be adjusted over
time to compensate for the progressive tissue
changes associated with denture wearing.4, 5 Advances in implant dentistry have allowed a shift
from a complete removable denture to an implant-supported overdenture for the oral rehabilitation of edentulous patients.6 The McGill
consensus statement in 20027, 8 and some independent studies 9–11 state that mandibular
two-implant overdentures are the gold standard
for edentulous patients. However, technical and
biological complications can occur.12–15
In two pilot retrospective studies, Maló et al.
presented a planning protocol for the rehabilitation of the edentulous mandible and maxilla
using four implants (All-on-4, Nobel Biocare,
Kloten, Switzerland) to overcome anatomical
limitations in the mandible that make it challenging to treat without the use of more complex
techniques.16, 17 The two most anterior implants
are placed axially, and the posterior implants are
placed in an angled position to maximize implant
length and avoid anatomical structures (i.e., the
mental nerve and anterior border of the maxillary
sinus). The All-on-4 treatment concept seems
to be a safe, effective and efficient surgical and
prosthetic procedure on both jaws after ten
years in function.18, 19 However, as conﬁrmed in
a recent systematic review, few independent
uncontrolled prospective and retrospective studies have conﬁrmed these preliminary results.20
The purpose of this prospective observational study was to evaluate the three-year clinical
and radiographic outcomes of implant-supported complete-arch ﬁxed dental prostheses (FDPs)
delivered on four implants placed according to
the All-on-4 protocol in edentulous or partially
edentate patients with a preference for an implant-supported restoration. This study followed
the Strengthening the Reporting of Observational Studies in Epidemiology guidelines.21

This prospective observational study was designed to evaluate patients treated according to
the All-on-4 protocol in the mandible or maxilla.
The patients were selected and treated in two
private centers in Rome and Sassari, between
January 2008 and December 2011.
The inclusion criteria were a healthy patient
aged 18 years or older at the time of implant placement, able to give her or his informed consent for
participation, with a residual alveolar crest, distal
to the ﬁrst premolar, of ≤ 5 mm in height and
≤ 4 mm in width, assessed by computed tomography (CT) or scans, and refusal of a conventional bone augmentation procedure; partially
edentate patient with hopeless dentition based
on multiple risk factors, including endodontic22
and periodontal criteria,23 prosthetic restorability of the tooth, cost–beneﬁt ratio and patient
preference in terms of refusing any major bone
augmentation procedures.
The exclusion criteria were general medical
(American Society of Anesthesiologists Physical
Status Class III or IV) and/or psychiatric contraindications; pregnancy or nursing; any interfering
medication, such as steroid therapy or bisphosphonate therapy; alcohol or drug abuse; heavy
smoking (> 10 cigarettes/day); radiation therapy
to the head or neck region within ﬁve years; high
or moderate parafunctional activity; untreated
periodontitis; poor oral hygiene and motivation,
deﬁned as full-mouth bleeding on probing and a
full-mouth plaque index of ≥ 25%; known allergic
or adverse reactions to the restorative material;
and unavailability for regular follow-ups.
This investigation was conducted according
to the principles embodied in the Declaration of
Helsinki of 1975 for biomedical research involving
human subjects, as amended in 2008. All of patients were duly informed about the nature of the
study and gave their written consent.
Before implant placement, all of the patients
underwent CT or CBCT scan according to a double-scan protocol.24 In the case of immediately
post-extraction implants, a previously reported
two-piece radiographic guide was used for the
diagnostic study and for virtual implant planning.25, 26 If the operator decided to wait for healing of the post-extraction socket, the implant
sites had to heal for at least three months before
radiographic examination (Figs. 1–2).
DICOM data of the two sets of scans were
transferred to a 3-D software planning program
(NobelGuide, Nobel Biocare) and matched to each

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 17

[18] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Figs. 1 & 2

Fig. 1
Pretreatment intra-oral photograph.
Fig. 2
Intra-oral photograph three
months after tooth extractions.

Figs. 3 & 4

Fig. 3
Try-in of the dental set-up
modeled on the established
vertical dimension of occlusion
according to functional and
esthetic parameters.
Fig. 4
Screw-retained temporary
restoration.

Figs. 5 & 6

Fig. 5
Intra-oral photograph of the
temporary restoration
screwed onto the implants.
Fig. 6
Intra-oral photograph ﬁve
days after ﬂapless implant
placement.

Fig. 7

Fig. 7
Periapical radiographs ﬁve
days after implant placement.

other. Four implants were planned for the rehabilitation of each participant in post-extraction
or healed sockets, according to the All-on-4 protocol.16, 17 Planning data of the patients who required template-guided surgery were sent to a
milling center (NobelProcera, Nobel Biocare),
where stereolithographic surgical templates
18 Volume 2 | Issue 2/2016

with hollow metallic cylinders to guide implant
placement in the virtually planned position were
fabricated. Patients received professional oral
hygiene prior to the surgery and were instructed
to rinse with a 0.2% chlorhexidine mouthwash for 1 min, starting two days prior to the
intervention.

Journal of
Oral Science & Rehabilitation

[19] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Surgical protocol

An antibiotic (2 g of amoxicillin and clavulanic
acid or 600 mg clindamycin if allergic to penicillin) was administered 1 h prior to surgery and
continued for six days (1 g amoxicillin and clavulanic acid or 300 mg clindamycin b.i.d.) after
surgery. Local anesthesia was induced using a
4% articaine solution with 1:100,000 epinephrine (Ubistesin; 3M Italia, Milan, Italy). Implants
were placed in the planned anatomical sites either conventionally or using a fully guided approach. A ﬂapless or a ﬂap approach was performed in order to maintain an adequate
residual band of keratinized mucosa around the
implants. When the alveolar crest was too thin
(knife edge) to place the implant, the alveolar
crest was remodeled using piezoelectric bone
surgery under copious irrigation with sterile saline to obtain a ﬂat bony crest. Each patient received four NobelSpeedy Groovy implants (Nobel Biocare), featuring a ﬂat-to-ﬂat matched
implant-abutment interface with a 0.7 mm tall
external hexagonal prosthetic connection and a
rough, highly crystalline and phosphate-enriched titanium oxide surface (TiUnite, Nobel
Biocare). All of the implants were placed according to the surgical and prosthetic protocols recommended by the manufacturer (IFU 73494
Manual 2/All-on-4 and IFU 71286), with no deviations from the original protocol. The drilling
sequence was chosen according to the manufacturer’s instructions in relation to the bone
quality, achieving an insertion torque at implant
placement ranging from 35 to 45 N cm in the
mandible or from 35 to 55 N cm in the maxilla,
measured using a surgical unit (OsseoCare Pro
Drill Motor Set, Nobel Biocare). In the post-extraction sites, the gaps between the implants
and the surrounding socket walls were ﬁlled with
0.25–1 mm granules of deproteinized bovine
bone (Geistlich Bio-Oss or Geistlich Bio-Oss Collagen, Geistlich Pharma, Wolhusen, Switzerland), hydrated using the patient’s blood mixed
with antibiotic solution (Rifocin 250 mg/10 mL,
Sanoﬁ-aventis, Milan, Italy).
Seventeen- or thirty-degree angled multi-unit abutments (Nobel Biocare) were immediately connected to the distal implants for better orientation of the screw access hole. Straight
multi-unit abutments (Nobel Biocare) were used
in the anterior implants if needed.
A prefabricated screw-retained acrylic resin
provisional restoration without any cantilever
was delivered immediately after surgery

(Figs. 3–5). All of the patients received oral and
written recommendations regarding medication,
oral hygiene maintenance and diet. Post-surgical
analgesic treatment was provided with ibuprofen 600 mg, administered every 8 h for two days
after the surgery, and later on if needed. The
patients were instructed to rinse the mouth with
a 0.2% chlorhexidine mouthwash t.i.d. without
brushing the implant area (Figs. 6 & 7).
Prosthetic protocol

After three to four months of healing, a deﬁnitive
impression was taken at the implant or abutment
level according to a previously reported protocol.27 Deﬁnitive prostheses with titanium or zirconia frameworks, fabricated using CAD/CAM
technology (NobelProcera), were screwed on at
either the implant or abutment level according
to the manufacturer’s instructions three to ﬁve
months after implant placement (in the mandible
and the maxilla, respectively). The deﬁnitive implant-supported complete-arch FDP was designed with (hybrid design) or without pink material in the cervical region (crown design) and
veneered with ceramic, acrylic or composite
according to the patients’ needs (Figs. 8a–c).
Clinical accuracy of the framework (strain-free
screwing and absence of an open margin upon
clinical and radiographic examination) was evaluated before prosthesis delivery.28–30 The occlusion was adjusted avoiding any premature contacts. Mutually protected occlusion with
anterior guidance or balanced occlusion was used
in cases of opposing natural dentition or an FDP
and complete removable denture, respectively.
Follow-up visits were scheduled at one and six
months and then annually up to ﬁve years of
function. The patients underwent a professional
cleaning by a dental hygienist every four to six
months (Figs. 9a–c). Panoramic and periapical
radiographs were obtained annually after deﬁnitive prosthesis delivery (Fig. 10).
The primary outcome measures were as follows:
– An implant was classiﬁed as “successful” when
the following criteria31 were fulﬁlled: did not
cause pain or suppuration, did not show any mobility, did not show any signs of radiolucency, and
did not show periimplant bone loss of > 1.5 mm
during the ﬁrst year and then > 0.2 mm yearly.
– An implant was classiﬁed as “surviving” when
the implant remained in the jaw and was stable
after the prosthesis was removed, even though
all of the success criteria were not fulﬁlled.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 19

[20] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Figs. 8a–c

c
Figs. 9a–c

c
Fig. 10

Figs. 8a–c
Lateral (a & c) and frontal (b)
intra-oral photographs of the
carbon-ﬁber-reinforced deﬁnitive prosthesis screwed onto
the implants.
Figs. 9a–c
Lateral (a & c) and frontal (b)
intra-oral photographs of the
deﬁnitive prosthesis taken
three years after implant
placement.
Fig. 10
Panoramic radiograph three
years after implant placement.

– An implant-supported complete-arch FDP was
deﬁned as “successful” when the dental prosthesis remained in function and the esthetic
evaluation, assessed by the dentist and the patient, was satisfactory during the study period.
– An implant-supported complete-arch FDP was
considered as “surviving” when the dental
prosthesis remained in function, even though
all of the success criteria were not fulﬁlled.
The secondary outcome measures were as follows:
– Any technical (fracture of the framework and/
or the veneering material, screw loosening,
etc.) and/or biological (pain, swelling, suppuration, etc.) complications were considered.
– The distance from the most coronal margin of
the implant collar and the most coronal point
of bone-to-implant contact was taken as the
marginal bone level. This level was evaluated
on intra-oral digital radiographs taken with the
20 Volume 2 | Issue 2/2016

paralleling technique using a ﬁlm holder (Rinn
XCP, DENTSPLY, Elgin, Ill., U.S.) at implant
placement (baseline) and then yearly up to
three years of function. Radiographs were accepted or rejected for evaluation based on the
clarity of the implant threads. All readable radiographs were displayed in image analysis
software (Digora for Windows 2.8, SOREDEX,
Tuusula, Finland) that was calibrated for every
single image using the known measure of the
implant thread pitch. Measurements of the
mesial and distal bony crest level adjacent to
each implant were made to the nearest 0.1 mm
and averaged at the patient level.
– Patient satisfaction was evaluated with a questionnaire one month after delivery of the ﬁnal
prosthesis and at the three-year follow-up
examination, provided by independent and
blinded outcome assessors. The assessor
asked the following questions: Are you satis-

Journal of
Oral Science & Rehabilitation

[21] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

ﬁed with the function of your implant-supported prosthesis? Are you satisﬁed with the esthetic outcome of your implant-supported
prosthesis? Would you undergo the same
therapy again?
An independent assessor evaluated the implant
and prosthesis survival and success rates. Complications were assessed and treated by the same
clinicians. The marginal bone loss was evaluated
by an independent radiologist.
Statistical analysis

Patient data were collected in an Excel spreadsheet (Microsoft). Finally, all of the data were
exported into IBM SPSS Statistics for Macintosh
(Version 22.0; IBM, Armonk, N.Y., U.S.) for statistical analysis. A bio-statistician with expertise
in dentistry analyzed the data using PASW Statistics for Windows (Version 18.0; SPSS, Chicago,
Ill., U.S.). Descriptive analysis was performed for
numeric parameters using mean ± standard deviation (median; 95% CI). Dichotomous and continuous outcomes were compared using the chisquared test and one-way analysis of variance,
respectively. Differences in the proportions of
patients with implant failures, prosthesis failures
and complications (dichotomous outcomes) were
compared between the subgroups using the Fisher exact test. Patient was the statistical unit of
the analyses. All statistical comparisons were
conducted at a 0.05 level of signiﬁcance.

Results
Thirty-two patients were screened for eligibility.
Two patients were not enrolled in the trial, because of refusal to sign the informed consent. A
total of 120 NobelSpeedy Groovy implants were
placed using either computer-assisted template-guided (n = 15) or conventional freehand
surgery (n = 15) in 30 consecutive patients
(18 females and 12 males) with a mean age of
67.4 ± 6.9 (range of 51–87). Thirty CAD/CAM
screw-retained implant-supported complete-arch FDPs (18 in the mandible and 12 in the
maxilla) were delivered. No patients dropped out
of the study within three years after implant
placement and no deviation from the original
protocol occurred. All of the patients were followed up for a minimum period of three years
(mean of 53.8 months; range of 36–84 months).
Data collected were included in the statistical

analysis. The main patients’ and interventions’
characteristics are summarized in Table 1.
At the three-year follow-up examination, one out
of 120 implants (0.8%) had failed, resulting in a
cumulative implant survival rate of 99.2%. The
only implant failure occurred in one patient two
months after placement, before delivery of the
ﬁnal prosthesis. The affected implant had an infectious etiology (pain, swelling and suppuration)
and it was 11.5 mm long in position 16, placed
using guided surgery in a healed site. The implant
was replaced three months after bone healing.
The temporary prosthesis was shortened, but not
replaced by a conventional complete removable
denture, and the patient was adequately informed and instructed to pay attention and follow
a soft diet. At the three-year follow-up examination, no deﬁnitive prostheses had failed, resulting
in a cumulative prosthesis survival rate of 100%.
Eleven patients experienced one technical or
biological complication each, resulting in eight
technical and three biological complications reported during the entire follow-up period. Six
technical and one biological complication were
reported during the healing period with temporary prostheses, while two technical and two
biological complications were reported after deﬁnitive prosthesis delivery. All of the complications were successfully resolved.
Three prosthetic screws loosened in the temporary prostheses (in three patients) during the
healing period, and this was resolved by retightening the screws, stabilizing the occlusion and
advising the patients not to overload the prostheses (not to ingest food that may require signiﬁcant masticatory effort). Three fractures of the
provisional acrylic prostheses occurred (in three
patients) during the healing period. The temporary prosthesis was adjusted chairside, the occlusion was stabilized and a night guard was
delivered for each patient. Fracture of the composite veneering material of the deﬁnitive implant-supported cross-arch FDP occurred in one
patient two years after loading, most likely due
to occasional parafunctional habits. These situations were resolved by adjusting the deﬁnitive
prosthesis chairside, stabilizing the occlusion and
a delivering a night guard.
The ﬁrst biological complication was reported
six weeks after implant placement in an 11.5 mm
long implant placed in position 45, using guided
surgery in a healed site. The patient reported pain
and swelling without suppuration. The temporary
abutment was replaced with a healing abutment.
The temporary prosthesis was shortened to the

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 21

[22] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

right canine. The implant was left to heal for four
months according to a conventional loading protocol. The other two complications were periimplantitis, consisting of a mean mesiodistal periimplant bone loss of 2.6 and 2.8 mm, reported at
the one-year follow-up examination. The ﬁrst
case of periimplantitis developed around a 15 mm
long implant in position 35, placed using conventional freehand surgery in a healed site. The second case developed around a 13 mm long implant
in position 32, placed using guided surgery in a
healed site and immediately loaded. No other
technical or biological complications occurred
during the entire follow-up period.
After an initial mean marginal bone loss of
1.16 ± 0.40 mm (1.06 mm; 95% CI: 0.92–1.20), all
of the implants lost a mean of 0.21 ± 0.11 mm
(0.20 mm; 95% CI: 0.16–0.24) between the oneand two-year follow-ups, and 0.16 ± 0.07 mm
(0.15 mm; 95% CI: 0.13–0.17) between the twoand three-year follow-ups. At the three-year
follow-up, the mean marginal bone loss was
1.52 ± 0.41 mm (1.42 mm; 95% CI: 1.27–1.57). The
radiographic data are shown in Table 2.
All of the patients were fully satisﬁed with
the function and esthetics of their deﬁnitive prostheses, and all of the patients declared that they
would undergo the same treatment again.
Maxilla versus mandible

Twelve patients were treated in the maxilla, while
18 patients were treated in the mandible. There
were no statistically signiﬁcant differences between centers for the number of patients who
had failed implants (1/12 vs. 0/18; risk ratio = NA;
p = 0.399) or complications (3/12 vs. 8/18; risk
ratio = 0.5625; 95% CI: 0.19–1.70; p = 0.442). At
the three-year follow-up examination, the mean
marginal bone loss was 1.49 ± 0.34 mm (1.42 mm;
95% CI: 1.23–1.61) in the maxilla versus
1.54 ± 0.46 mm (1.38 mm; 95% CI: 1.17–1.59) in
the mandible (p = 0.756). The radiographic data
are shown in Table 3.
Guided versus
conventional freehand surgery

Fifteen patients were treated using computer-assisted template-based surgery and 15 with conventional freehand surgery. There were no statistically signiﬁcant differences between centers
for the number of patients who had failed
implants (1/15 vs. 0/15; risk ratio = NA; p = 0.999)
or complications (4/15 vs. 7/15; risk ratio = 0.5714;
22 Volume 2 | Issue 2/2016

95% CI: 0.21–1.55; p = 0.449). At the three-year
follow-up examination, the mean marginal bone
loss was 1.48 ± 0.47 mm (1.33 mm; 95% CI:
1.09–1.57) in the guided surgery group versus
1.55 ± 0.34 mm (1.46 mm; 95% CI: 1.29–1.63) in
the conventional freehand surgery group
(p = 0.365). The radiographic data are shown
in Table 3.

Discussion
The present study reported data on 30 implant-supported restorations delivered according
to the All-on-4 protocol and followed for at least
three years after implant placement. Because it
was designed as a single-cohort prospective
study, the main limitation of the present research
was the lack of a control group and the small sample size. Another limitation of the present study
was the variability within the cohort of patients.
In the present study, the three-year implant
(99.2%) and prosthesis success rates (100.0%),
as well as the mean bone loss of 1.52 ± 0.41 mm,
indicate that the All-on-4 treatment concept is a
promising treatment modality. Furthermore, the
results of this prospective observational study
are consistent with other studies investigating
the same topic.
A recent systematic review by Patzelt et al.,
which included 4,804 implants, demonstrated
a mean cumulative implant and prosthesis survival rate at three years of 99.0 ± 1.0% and
99.9 ± 0.3%, respectively.20 The mean bone loss
at three years amounted to 1.3 ± 0.4 mm. However, 12 out of the 13 included studies were considered to be highly biased. Most of the studies
included (69%) in the systematic review derived
from a limited number of investigators in Italy and
Portugal, which may limit the generalizability of
the ﬁndings, and only 31 % of the studies reported
a completed follow-up period of three years.
Malo et al. retrospectively reported a cumulative patient-related success rate of 93.8% up
to ten years of follow-up in the mandible and a
prosthesis survival rate of 99.2%.18 In the maxilla, a ﬁve-year survival rate of 93% was reported,
and the survival rate of the prostheses was
100%.19 The mean marginal bone loss was
1.52 ± 0.30 mm after three years. Similar results
were reported by Browaeys et al., who highlighted unacceptable ongoing bone loss in 49.2% of
the patients.32
Balshi et al. retrospectively analyzed the outcomes of 200 arches (800 implants) treated

Journal of
Oral Science & Rehabilitation

[23] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

Table 1

Table 1

Total

Patients’ and interventions’
characteristics.

Males

12 (40.00%)

Females

18 (60.00%)

Mean age at implant placement

67.4 ± 6.9

Smokers (< 10 cigarettes/day)

5 (16.67%)

Patients treated in the maxilla

12 (40.00%)

Patients treated in the mandible

18 (60.00%)

Patients treated using guided surgery

15 (50.00%)

Patients treated using conventional surgery

15 (50.00%)

Post-extraction implants

19 (15.83%)

10.0 mm implant length

14 (11.67%)

11.5 mm implant length

42 (35.00%)

13.0 mm implant length

62 (51.67%)

15.0–16.0 mm implant length

2 (1.67%)

Patients with prosthesis failures

0

Patients with implant failures

1 (3.33%)

Patients with complications

11 (36.67%)

Table 2

Table 2
Mean marginal bone loss
± standard deviation (mm)
(95% CI) between follow-up
examinations.

Follow-up period

Baseline to 1 year

1–2 years

2–3 years

Baseline to 3 years

1.16 ± 0.40
(0.92–1.20)

0.21 ± 0.11
(0.16–0.24)

0.16 ± 0.07
(0.13–0.17)

1.52 ± 0.41
(1.27–1.57)

Table 3

Table 3

Location

Type of surgery

†

Mandible (n = 18)

Maxilla (n = 12)

P-value

1.54 ± 0.46

1.49 ± 0.34

P = 0.756

Guided (n = 15)

Freehand (n = 15)

P-value†

Three-year marginal bone loss
± standard deviation (mm)
according to the jaw location
and type of surgery.
†

1.48 ± 0.47

1.55 ± 0.34

Journal of
Oral Science & Rehabilitation

P = 0.365

Volume 2 | Issue 2/2016 23

Unpaired t-test assuming
normal distribution.

[24] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

according to the All-on-4 protocol.33 Twenty
percent (168 implants out of 800) of the implants
analyzed had a follow-up period of three years or
more. Cumulative implant and prosthesis survival rates amounted to 97.3% and 99.0%, respectively.
Grandi et al. analyzed 47 patients treated with
188 immediately loaded implants placed in the
mandible according to the All-on-4 protocol in
post-extraction sites.34 At the 18-month follow-up, no implant had failed and all of the restorations were stable. However, three patients
experienced fracture of the provisional restoration. No signiﬁcant differences in bone loss were
found between axially placed and tilted implants
at the 18-month follow-up.
Babbush et al. retrospectively examined 165
patients treated according to the All-on-4 protocol.35 The cumulative implant survival rate was
99.6% (99.3% in the maxilla and 100.0% in the
mandible) for up to 29 months of loading. The
deﬁnitive prosthesis survival rate was 100%.
Recently, the same authors retrospectively analyzed the patient-centered outcomes, including
the cost of treatment, length of the treatment
period and comfort provided by the provisional
restoration, in patients treated according to the
All-on-4 protocol and compared these results to
a historical control group, which included complete-arch FDPs supported by natural teeth or
implants and implant-supported overdentures.36
This study demonstrated that the cost, length of
treatment and comfort provided by the provisional restoration signiﬁcantly favored the All-on-4
treatment modality.
In the present study, the overall percentage
of complications experienced was large (36.6 %).
Nevertheless, this result did not differ from those
normally encountered in oral rehabilitation in
which implants are used as support for an FDP
(33.6% at ﬁve years).37 Moreover, most of these
complications were reported on the temporary
restoration, during healing. The clinicians who
carried out the procedures addressed all of the
complications chairside. Furthermore, the condition of the patients remained stable up to the
completion of the three-year follow-up period. In
order to minimize the incidence of complications,
dental clinicians should exert great effort in selecting patients, respecting the original protocols, and
choosing reliable components and materials for
implant-supported complete-arch FDPs.
Patients with untreated periodontitis were
not included in the study. Implant therapy in patients with a history of chronic periodontitis and
24 Volume 2 | Issue 2/2016

generalized aggressive periodontitis might be
considered a viable treatment with similar survival outcomes to those reported for healthy patients. Periodontally compromised patients were
included after being treated to reduce the inﬂammation and halt the disease progression, before
tooth extraction and implant placement. According to Donos et al., it is necessary to treat and
control the periodontal disease, regardless of its
progression pattern and subtype, before implant
therapy is initiated in order to improve the overall implant success and achieve a more favorable bone resorption pattern.38 Nevertheless, a
comprehensive implant maintenance program
has to be encouraged and continued in order to
identify periimplant bone loss early on, particularly in patients with a history of periodontal disease.

Conclusion
Within the limitations of the present study, the
All-on-4 concept is a predictable and minimally
invasive treatment concept for the complete-arch
rehabilitation of both jaws, regardless of jaw location and type of surgery. It may decrease the
overall treatment time and re-establish adequate
function in a cost-effective way. Further longterm prospective data (ﬁve years and more) and
outcomes beyond cumulative survival rates are
needed.
Competing interests
The authors declare that they have no competing interests. This study was completely
self-ﬁnanced and no funding was sought or obtained, not even in the form of free materials.

Journal of
Oral Science & Rehabilitation

[25] => JOSR_2_A4.qxp_Layout 1

Three-year results of All-on-4 in daily practice

References
1.
Polzer I, Schimmel M, Müller F, Biffar R.
Edentulism as part of the general health
problems of elderly adults.
→ Int Dent J.
2010 Jun;60(3):143–55.
2.
Emami E, de Souza RF, Kabawat M, Feine JS.
The impact of edentulism on oral and general
health.
→ Int J Dent.
2013;2013:498305. doi:
10.1155/2013/498305. Epub 2013 May 8.
3.
Slade GD, Akinkugbe AA, Sanders AE.
Projections of U.S. edentulism prevalence
following 5 decades of decline.
→ J Dent Res.
2014 Oct;93(10):959–65.
4.
Felton D, Cooper L, Duqum I, Minsley G,
Guckes A, Haug S, Meredith P, Solie C, Avery
D, Chandler ND; American College of
Prosthodontists; Academy of General
Dentistry; American Dental Association
Council on Scientiﬁc Affairs; American Dental
Hygienists’ Association; National Association
of Dental Laboratories; GlaxoSmithKline
Consumer Healthcare. Evidence-based
guidelines for the care and maintenance of
complete dentures: a publication of the
American College of Prosthodontists.
→ J Am Dent Assoc.
2011 Feb;142 Suppl 1:1S–20S.
5.
Carlsson GE. Clinical morbidity and sequelae
of treatment with complete dentures.
→ J Prosthet Dent.
1998 Jan;79(1):17–23.
6.
Batenburg RH, Meijer HJ, Raghoebar GM,
Vissink A. Treatment concept for mandibular
overdentures supported by endosseous
implants: a literature review.
→ Int J Oral Maxillofac Implants.
1998 Jul;13(4):539–45.
7.
Feine JS, Carlsson GE, Awad MA, Chehade A,
Duncan WJ, Gizani S, Head T, Heydecke G,
Lund JP, MacEntee M, Mericske-Stern R,
Mojon P, Morais JA, Naert I, Payne AG, Penrod
J, Stoker GT, Tawse-Smith A, Taylor TD,
Thomason JM, Wismeijer D. The McGill
consensus statement on overdentures.
Mandibular two-implant overdentures as ﬁrst
choice standard of care for edentulous
patients.
→ Gerodontology.
2002 Jul;19(1):3–4.
8.
Thomason JM, Kelly SA, Bendkowski A, Ellis
JS. Two implant retained overdentures
–A review of the literature supporting the
McGill and York consensus statements.
→ J Dent.
2012 Jan;40(1):22–34.
9.
Harris D, Höfer S, O’Boyle CA, Sheridan S,
Marley J, Benington IC, Clifford T, Houston F,
O’Connell B. A comparison of implant-retained mandibular overdentures and
conventional dentures on quality of life in
edentulous patients: a randomized,
prospective, within-subject controlled clinical
trial.
→ Clin Oral Implants Res.
2013 Jan;24(1):96–103.

10.
Emami E, Heydecke G, Rompré PH, De
Grandmont P, Feine JS. Impact of implant
support for mandibular dentures on
satisfaction, oral and general health-related
quality of life: a meta-analysis of randomized-controlled trials.
→ Clin Oral Implants Res.
2009 Jun;20(6):533–44.

19.
Maló P, de Araújo Nobre M, Lopes A,
Francischone C, Rigolizzo M. “All-on-4”
immediate-function concept for completely
edentulous maxillae: a clinical report on the
medium (3 years) and long-term (5 years)
outcomes.
→ Clin Implant Dent Relat Res.
2012 May;14 Suppl 1:e139–50.

11.
Krennmair G, Seemann R, Fazekas A, Ewers R,
Piehslinger E. Patient preference and
satisfaction with implant-supported
mandibular overdentures retained with ball or
locator attachments: a crossover clinical trial.
→ Int J Oral Maxillofac Implants.
2012 Nov-Dec;27(6):1560–8.

20.
Patzelt SB, Bahat O, Reynolds MA, Strub JR.
The all-on-four treatment concept: a
systematic review.
→ Clin Implant Dent Relat Res.
2014 Dec;16(6):836–55.

12.
Jemt T. Failures and complications in 391
consecutively inserted ﬁxed prostheses
supported by Brånemark implants in
edentulous jaws: a study of treatment from
the time of prosthesis placement to the ﬁrst
annual checkup.
→ Int J Oral Maxillofac Implants.
1991 Fall;6(3):270–6.
13.
Jemt T, Book K, Lindén B, Urde G. Failures and
complications in 92 consecutively inserted
overdentures supported by Brånemark
implants in severely resorbed edentulous
maxillae: a study from prosthetic treatment to
ﬁrst annual check-up.
→ Int J Oral Maxillofac Implants.
1992 Summer;7(2):162–7.
14.
French D, Tallarico M. Eight-year clinical and
radiologic results of maxillary and mandibular
implant-retained bar overdentures carried out
on oxidized (TiUnite™) replace select implants
placed in regenerated bone: a clinical case.
→ Quintessence Int.
2014 Feb;45(2):135–40.
15.
Babbush CA, Tallarico M. Twelve-year clinical
and radiological results of maxillary and
mandibular implant-retained bar
overdentures carried out on oxidized (TiUnite)
replace select implants: a clinical case.
→ J Oral Implantol.
2013 Dec;39(6):737–42.
16.
Maló P, Rangert B, Nobre M. “All-on-Four”
immediate-function concept with Brånemark
System implants for completely edentulous
mandibles: a retrospective clinical study.
→ Clin Implant Dent Relat Res.
2003 Mar;5 Suppl 1:2–9.
17.
Maló P, Rangert B, Nobre M. All-on-4
immediate-function concept with Brånemark
System® implants for completely edentulous
maxillae: a 1-year retrospective clinical study.
→ Clin Implant Dent Relat Res.
2005 Jun;7 Suppl 1:S88–94.
18.
Malo P, de Araújo Nobre M, Lopes A, Moss
SM, Molina GJ. A longitudinal study of the
survival of All-on-4 implants in the mandible
with up to 10 years of follow-up.
→ J Am Dent Assoc.
2011 Mar;142(3):310–20.

21.
Von Elm E, Altman DG, Egger M, Pocock SJ,
Gøtzsche PC, Vandenbroucke JP. The
Strengthening the Reporting of Observational
Studies in Epidemiology (STROBE) statement:
guidelines for reporting observational studies.
→ J Clin Epidemiol.
2008 Apr;61(4):344–9.
22.
Zitzmann NU, Krastl G, Hecker H, Walter C,
Weiger R. Endodontics or implants? A review
of decisive criteria and guidelines for single
tooth restorations and full arch reconstructions.
→ Int Endod J.
2009 Sep;42(9):757–74.
23.
Becker W, Berg L, Becker BE. The long term
evaluation of periodontal treatment and
maintenance in 95 patients.
→ Int J Periodontics Restorative Dent.
1984;4(2)54–71.
24.
Van Steenberghe D, Naert I, Andersson M,
Brajnovic I, Van Cleynenbreugel J, Suetens P.
A custom template and deﬁnitive prosthesis
allowing immediate implant loading in the
maxilla: a clinical report.
→ Int J Oral Maxillofac Implants.
2002 Sep-Oct;17(5):663–70.
25.
Polizzi G, Cantoni T. Five-year follow-up of
immediate ﬁxed restorations of maxillary
implants inserted in both fresh extraction and
healed sites using the NobelGuide™ system.
→ Clin Implant Dent Relat Res.
2015 Apr;17(2):221–33.
26.
Cantoni T, Giovanni P. Implant treatment
planning in fresh extraction sockets: use of a
novel radiographic guide and CAD/CAM
technology.
→ Quintessence Int.
2009 Oct;40(9):773–81.
27.
Pozzi A, Tallarico M, Mangani F, Barlattani A.
Different implant impression techniques for
edentulous patients treated with CAD/CAM
complete-arch prostheses: a randomised
controlled trial reporting data at 3 year
post-loading.
→ Eur J Oral Implantol.
2013 Winter;6(4):325–40.
28.
Abduo J, Bennani V, Waddell N, Lyons K,
Swain M. Assessing the ﬁt of implant ﬁxed
prostheses: a critical review.
→ Int J Oral Maxillofac Implants.
2010 May-Jun;25(3):506–15.

Journal of
Oral Science & Rehabilitation

29.
Eisenmann E, Mokabberi A, Walter MH,
Freesmeyer WB. Improving the ﬁt of
implant-supported superstructures using the
spark erosion technique.
→ Int J Oral Maxillofac Implants.
2004 Nov-Dec;19(6):810–8.
30.
Katsoulis J, Mericske-Stern R, Rotkina L,
Zbären C, Enkling N, Blatz MB. Precision of ﬁt
of implant-supported screw-retained 10-unit
computer-aided-designed and computeraided-manufactured frameworks made from
zirconium dioxide and titanium: an in vitro
study.
→ Clin Oral Implants Res.
2014 Feb;25(2):165–74.
31.
Papaspyridakos P, Chen CJ, Singh M, Weber
HP, Gallucci GO. Success criteria in implant
dentistry: a systematic review.
→ J Dent Res.
2012 Mar;91(3):242–8.
32.
Browaeys H, Dierens M, Ruyffelaert C,
Matthijs C, De Bruyn H, Vandeweghe S.
Ongoing crestal bone loss around implants
subjected to computer-guided ﬂapless
surgery and immediate loading using the
All-on-4® concept.
→ Clin Implant Dent Relat Res.
2015 Oct;17(5):831–43.
33.
Balshi TJ, Wolﬁnger GJ, Slauch RW, Balshi SF.
A retrospective analysis of 800 Brånemark
System implants following the All-on-Four™
protocol.
→ J Prosthodont.
2014 Feb;23(2):83–8.
34.
Grandi T, Guazzi P, Samarani R, Grandi G.
Immediate loading of four (All-on-4)
post-extractive implants supporting
mandibular cross-arch ﬁxed prostheses:
18-month follow-up from a multicentre
prospective cohort study.
→ Eur J Oral Implantol.
2012 Autumn;5(3):277–85.
35.
Babbush CA, Kutsko GT, Brokloff J. The
All-on-Four immediate function treatment
concept with NobelActive implants: a
retrospective study.
→ J Oral Implantol.
2011 Aug;37(4):431–45.
36.
Babbush CA, Kanawati A, Kotsakis GA,
Hinrichs JE. Patient-related and ﬁnancial
outcomes analysis of conventional full-arch
rehabilitation versus the All-on-4 concept: a
cohort study.
→ Implant Dent.
2014 Apr;23(2):218–24.
37.
Schwarz F, Hegewald A, Becker J. Impact of
implant-abutment connection and positioning
of the machined collar/microgap on crestal
bone level changes: a systematic review.
→ Clin Oral Implants Res.
2014 Apr;25(4):417–25.
38.
Donos N, Laurell L, Mardas N. Hierarchical
decisions on teeth vs. implants in the
periodontitis-susceptible patient: the modern
dilemma.
→ Periodontol 2000.
2012 Jun;59(1):89–110.

Volume 2 | Issue 2/2016 25

[26] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Accelerated generation of human induced
pluripotent stem cells from human oral
mucosa using episomal plasmid vectors and
maternal transcription factor Glis1
Abstract
Objective
Takahiro Kashiwagi,a Yoshiya Hashimoto,b
Masahiro Tanakac & Shunsuke Babaa
a

Department of Oral Implantology, Osaka Dental
University, Hirakata, Japan
b
Department of Biomaterials, Osaka Dental University,
Hirakata, Japan
c
Department of Fixed Prosthodontics and Occlusion,
Osaka Dental University, Hirakata, Japan
Corresponding author:

Induced pluripotent stem cells (iPSCs) possess high pluripotency and differentiation potential and may constitute a possible source of autologous
stem cells for clinical applications. However, the lengthy reprogramming
process (up to one month) remains one of the most signiﬁcant challenges
facing standard virus-mediated methodology. The Gli-like transcription
factor Glis1 is highly expressed in unfertilized eggs and one-cell-stage
embryos. In this study, iPSCs were generated using a combination of primary human oral mucosal ﬁbroblasts (HOFs) and episomal plasmid vectors
expressing transcription factors, including Glis1.

Dr. Yoshiya Hashimoto
Materials and methods
yoshiya@cc.osaka-dent.ac.jp
How to cite this article:
Kashiwagi T, Hashimoto Y, Tanaka M, Baba S. Accelerated
generation of human induced pluripotent stem cells from
human oral mucosa using episomal plasmid vectors and
maternal transcription factor Glis1.
J Oral Science Rehabilitation.
2016 Jun;2(2):26–35.

HOFs were established from oral mucosal tissue 3 mm in diameter from
a 23-year-old Asian male using a skin trephine. Human iPSCs were generated from the established HOFs using the following episomal plasmid
vectors: pCXLE-hOCT3/4-shp53-F that expresses OCT3/4 and shorthairpin RNA (shRNA) against p53, pCXLE-hSK that expresses SOX2 and
KLF4, pCXLE-hUL that expresses L-MYC and LIN28, and pCXLE-hGlis1
that expresses Glis1.
Results

Fifty colonies of human embryonic stem (ES)-like cells were observed as
early as 20 days after initial episomal plasmid vector transduction. The
resulting cell lines shared several characteristics with human ES cells,
including morphology, pluripotency-associated gene and protein markers,
karyotype analysis and the ability to differentiate in vivo into all three germ
layers.
Conclusion

Our method, combining the use of HOFs and episomal plasmid vectors
expressing OCT3/4, shRNA against p53, SOX2, KLF4, L-MYC, LIN28 and
Glis1, offers a powerful tool for safely and rapidly generating bona ﬁde
human iPSCs and facilitates the application of iPSC technology to biomedical research.
Keywords

iPSC, integration-free plasmid vector, Glis1, human oral mucosal tissue.
26 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[27] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Introduction

human oral mucosal ﬁbroblasts (HOFs) with
episomal plasmid vectors expressing OCT3/4,
The successful reprogramming of human and short-hairpin RNA (shRNA) against p53, SOX2,
mouse somatic cells into induced pluripotent KLF4, L-MYC, LIN28 and Glis1.
stem cells (iPSCs) via ectopic overexpression of
pluripotency-associated transcription factors is
considered a major scientiﬁc breakthrough.1–5
Materials and methods
Similar to the characteristics of embryonic stem
(ES) cells,6–8 human iPSCs can proliferate indefEthical statement
initely, while retaining pluripotency, and can differentiate into all cell types found in the body. Approval for the sampling of human oral mucosa
IPSCs have been generated from dermal ﬁbro- tissue, establishing iPSCs and genome/gene
blasts,3 peripheral blood,9 dental pulp cells,10 analysis was obtained from the Ethics Committee
gingival ﬁbroblasts,11 periodontal ligaments,12 oral of Osaka Dental University, Hirakata, Japan (aumucosa13 and mesenchymal stromal cells.14
thorization No.: 110783; approval date: 30 SepGingival tissue is routinely resected during tember 2013) and the DNA Recombination Exgeneral dental treatments, such as tooth extrac- periment Safety Committee of Osaka Dental
tion, periodontal surgery and dental implanta- University (authorization No.: 54; approval date:
tion, and generally treated as biomedical waste.15 18 July 2014). Written informed consent was
Egusa et al. successfully derived iPSCs from obtained from the participant. The animal experhuman gingival ﬁbroblasts (HGFs) using retro- iments followed a protocol approved by the Anviral transduction of transcription factors; they imal Committee of Osaka Dental University (aualso reported that the reprogramming efficiency thorization No.: 14-06002; approval date: 8 July
of mouse gingival ﬁbroblasts was higher than 2014).
that of dermal ﬁbroblasts.11 However, retroviral
integration increases the risk of tumor formaCell culturing
tion, while integration-free methods decrease
this potential risk.15 The development of novel HOFs were established from oral mucosal tissue
approaches to generating integration-free iPSCs 3 mm in diameter obtained using a skin trephine
has eliminated the concern of integrating (derma punch, Maruho, Osaka, Japan) from a
virus-associated genotoxicity in clinical applica- 23-year-old Asian male. Human oral mucosal
tions.16 Integration-free human iPSCs have been tissue was placed in 35 mm tissue culture dishes
generated using several methods.15 Okita et al. and cultured in Dulbecco’s Modiﬁcation of Eagle’s
reported a simple method that uses p53 sup- Medium (DMEM) containing 10% fetal bovine
pression and nontransforming L-MYC to gene- serum at 37 °C and 5% CO2.11 The medium was
rate human iPSCs with episomal plasmid vec- replaced every three days. Once the HOFs had
tors.15 Our recent study demonstrated that iPSCs proliferated, the tissue was removed. When the
could be generated from a combination of pri- cells reached subconﬂuence, they were dissocimary HGFs and an episomal plasmid vector.17 ated using 0.25% trypsin (Invitrogen, Carlsbad,
However, the lengthy reprogramming process Calif., U.S.) and transferred to 60 mm tissue cul(up to one month) remains one of the most sig- ture dishes (passage 1). HOFs were regularly
nificant challenges facing standard virus- passaged at a 1:3 ratio every three to four days.
mediated methodology.
Maekawa et al. reported that the Gli-like
Generation of iPSCs from
transcription factor Glis1 (Glis family zinc ﬁnger 1)
HOFs with episomal vectors
markedly enhances the generation of iPSCs from
both mouse and human somatic fibroblasts One microgram of an expression episomal plaswhen it is expressed together with three tran- mid mixture containing pCXLE-hOCT3/4scription factors collectively known as OSK shp53-F that expresses OCT3/4 and shRNA
(OCT3/4, SOX2 and KLF4) using retroviral trans- against p53, pCXLE-hSK that expresses SOX2
duction.18 However, little is known regarding and KLF4, pCXLE-hUL that expresses L-MYC and
whether Glis1 can effectively promote direct LIN28, and pCXLE-hGlis1 that expresses Glis1
reprogramming during iPSC generation using (Addgene, Cambridge, Mass., U.S.) was electroan episomal plasmid vector. In the current study, porated into 6 × 105 primary HOFs (passage 5)
iPSCs were generated by combining primary with the Amaxa 4D-Nucleofector (Lonza, Basel,
Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 27

[28] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Table 1

Primer

Gene

Sequences (5’ to 3’)
Forward

GAAACCCACACTGCAGCAGA

Reverse

TCGCTTGCCCTTCTGGCG

Forward

CTCAGCTACAAACAGGTGAAGAC

Reverse

TCCCTGGTGGTAGGAAGAGTAAA

Forward

GGGAAATGGGAGGGGTGCAAAAGAGG

Reverse

TTGCGTGAGTGTGGATGGGATTGGTG

Forward

CGCTCCATTACCAAGAGCTCAT

Reverse

CGATCGTCTTCCCCTCTTTG

Forward

CGTACAGGTTTCACGCATGTG

Reverse

ATGACGCGCAGGAAAAATGT

Forward

GTTGGTCAGGCTGGTCTTGAA

Reverse

CATGCGCCTGTAATCCTAGCA

Forward

CCACTCCTCCACCTTTGACG

Reverse

ATGAGGTCCACCACCCTGTT

OCT3/4

NANOG

SOX2
Pluripotent
marker
KLF4

TERT

C-MYC

Internal control

Table 1
List of primers used for
qRT-PCR.

GAPDH

Switzerland) according to the manufacturer’s
instructions using program DT-130 (Lonza).
These cells were then transferred on to mitomycin C-treated SNL 76/7 cells (cat. No. 07032801,
lot No. 08F009; European Collection of Authenticated Cell Cultures, Porton Down, U.K.) at
5 × 104 cells per 100 mm dish. The following day,
the culture medium was replaced with embryonic stem cell (ESC) culture medium consisting
of DMEM/F12 medium (Sigma-Aldrich, St.
Louis, Mo., U.S.) supplemented with 20% KnockOut Serum Replacement (Gibco, Grand Island,
N.Y., U.S.), 2 mM L-glutamine (Nacalai Tesque,
Kyoto, Japan), 1% nonessential amino acids (Gibco), 0.1 mM 2-mercaptoethanol (Gibco) and 5 ng/
mL fibroblast growth factor-2 (ReproCELL,
Kanagawa, Japan). Thirty days subsequent to
transduction, a number of colonies were mechanically picked and transferred to a 24-well plate.
After several passages, ESC-like colonies were
selected for further cultivation and characterization. IPSCs were generated and maintained in
ESC culture medium. For routine passaging, iPSC
colonies were detached with CTK solution
(2.5 μg/mL trypsin, 1 mg/mL collagenase IV, 20%
KSR, 1 mM CaCl2/PBS, and 70% PBS) and split
at a 1:3 ratio every four to ﬁve days.
28 Volume 2 | Issue 2/2016

Quantitative real-time
reverse transcriptionpolymerase chain reaction

Total RNA was isolated using the RNeasy Micro
Kit (Qiagen, Limburg, Netherlands) according to
the manufacturer’s protocol. Single-stranded
complementary DNA was synthesized from a
total of 500 ng RNA (DNase-treated) using the
PrimeScript RT Master Mix (Takara, Shiga,
Japan). KhES-1 RNA was provided by the Foundation for Biomedical Research and Innovation
(Kobe, Japan). Quantitative real-time reverse
transcription-polymerase chain reaction (qRTPCR) was conducted in triplicate using SYBR
Select Master Mix (Life Technologies, Grand
Island, N.Y., U.S.) with a StepOnePlus system (Life
Technologies) and the following PCR program:
95 °C for 10 min, then 40 cycles of 95 °C for 15 s,
60 °C for 1 min and 72 °C for 15 s. Speciﬁc primers
are listed in Table 1. The glyceraldehyde-3phosphate dehydrogenase (GAPDH) gene was
co-ampliﬁed as an internal standard. Gene expression was measured using the ΔΔCT method.20
Differences in gene expression between KhES-1,
HOF-iPSCs and HOFs were evaluated by variance
analysis with the Tukey test.

Journal of
Oral Science & Rehabilitation

[29] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Table 2

Antibodies

Supplier

Cat. No

Dilution

OCT3/4

Santa Cruz Biotechnology,
Dallas, Texas, U.S.

SC5279

1/100

NANOG

Cell Signaling Technology,
Danvers, Mass., U.S.

3680S

1/100

SSEA-3

Abcam, Cambridge, Mass.,
U.S.

ab16286

1/100

SSEA-4

Millipore, Billerica, Mass., U.S.

MAB4360

1/100

TRA-1-60

Millipore, Billerica, Mass., U.S.

MAB4304

1/100

TRA-1-81

Millipore, Billerica, Mass., U.S.

MAB4381

1/100

DAPI

Invitrogen, Carlsbad, Calif.,
U.S.

D1306

5 μg/mL

Alexa Fluor 594 mouse

Invitrogen, Carlsbad, Calif.,
U.S.

A11062

1/500

Alexa Fluor 594 rat

Invitrogen, Carlsbad, Calif.,
U.S.

A21211

1/500

Surface antigen analysis

Cells (5 × 105) were obtained after treatment with
0.025% trypsin (Life Technologies). Cell surface
antigen staining was performed in phosphate-buffered saline (PBS) with 2% human
serum albumin (Mitsubishi-Tanabe Pharma, Osaka, Japan). The cell suspension was incubated
with the antibodies listed in Table 2 for 30 min at
4 °C. Murine anti-human antibodies were used
at the recommended concentrations. Primary
antibodies and isotype controls are listed in Table
2. The stained cells were analyzed with FACSAria II (Becton Dickinson, Franklin Lakes, N.J., U.S.)
and the data were analyzed using the FlowJo
software (Tree Star, Ashland, Ore., U.S.).
Immunocytochemistry

For ﬁxed staining of differentiation-speciﬁc markers, cells were ﬁxed for 30 min in 4% paraformaldehyde at 4 °C, followed by washing in PBS. The
cells were then permeabilized for 15 min with 2%
bovine serum albumin and 0.1% Triton X-100 (Sigma-Aldrich) and incubated overnight at 4 °C with
the primary antibodies diluted in PBS containing
2% bovine serum albumin. The cells were then

washed and incubated for 1 h with the appropriate
ﬂuorescence-conjugated secondary antibodies.
Primary antibodies and secondary antibodies are
listed in Table 2. The staining images were acquired with a ZOE Fluorescent Cell Imager (BioRad Laboratories, Hercules, Calif., U.S.).
In vivo differentiation
(teratoma formation)

NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice (Jackson
Laboratory, Bar Harbor, Maine, U.S.) were anesthetized and iPSCs (1 × 106) were transplanted
under the epidermal space of the neck. Two hundred microliters of saline was injected into a
second epidermal space as a negative control.
Mice were euthanized 12 weeks later and teratoma samples were collected and subjected to
histological analysis. Teratomas were processed
according to standard paraffin embedding and
hematoxylin and eosin staining procedures by
the Business Support Center for Biomedical Research Activities (Kobe, Japan).

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 29

Table 2
Antibodies used for ﬂow
cytometry and immunochemical staining of
HOF-iPSCs.

[30] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Table 3

Table 3
ESC-like colonies obtained
from HOFs. The number of
colonies per 5 × 104 cells after
cell reprogramming with
episomal vectors. These data
were obtained from three
independent induction
experiments using HOFs from
a donor.

ES–like

Non-ES–like

HOFs

Fig. 1

Fig. 1
Excision of oral mucosal tissue
by punch biopsy.

picked at passage 1. Several days later, four ESClike colonies were selected and expanded. All
Chromosome G-band analysis was performed at colonies were similar to ESCs in morphology
Nihon Gene Research Laboratories (Sendai, and proliferative capacity and were named
Japan). At least 15 metaphases were analyzed. “HOF-iPSCs”.
Karyotype analysis

Expression of ESC-specific

Results

marker genes in HOF-iPSCs

Generation of iPSCs from HOFs

HOF-iPSCs were selected for characterization
from among the picked clones after 23 passages
based on their higher level of proliferation and
stability of the ESC-like morphology. The expression of the ESC-speciﬁc marker genes OCT3/4,
NANOG, SOX2, TERT, KLF4 and C-MYC in
HOF-iPSCs was analyzed using qRT-PCR (Fig. 3).
Expression of NANOG and SOX2 was signiﬁcantly higher and that of C-MYC and TERT was lower
in KhES-1 cells compared with that in HOF-iPSCs
(Figs. 3b–e). No signiﬁcant difference was observed between KhES-1 and HOF-iPSCs for
OCT3/4 and KLF4 expression (Figs. 3a & f). KLF4
was the only gene to exhibit higher expression in
HOF cells compared with both the KhES-1 cells
and HOF-iPSCs (Fig. 3f).

using episomal plasmid vectors

Three lines of HOFs were established from the
oral mucosa of the 23-year-old Asian male
(Fig. 1). Homogeneous ﬁbroblasts emerged from
the oral mucosal tissue one week after the start
of culturing. HOFs were exponentially expanded
up to 30 passages; cells were counted at each
passage and plated at 1.5 × 104 cells/cm2. Colonies with a ﬂat human ESC-like morphology and
non-ESC-like colonies were counted at around
day 20 after HOF transfection with episomal
plasmid vectors expressing human OCT3/4,
shRNA against p53, SOX2, KLF4, L-MYC, LIN28
and Glis1. The average number of ESC-like colonies from three experiments was 54.7 ± 3.05,
with a reprogramming efficiency of approximately
Characterization of HOF-iPSCs
1%; the average number of non-ESC-like colonies
was 25.3 ± 3.21 (Table 3). A number of colonies HOF-iPSCs were selected for characterization
obtained from the HOF cells were mechanically from among the picked clones after 20 passages
30 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[31] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Fig. 2

Figs. 2 a–c
Generation of HOF-iPSCs.
(a) Time course for HOF
reprogramming.
(b) Microscopy image of
original HOFs in culture.
(c) Generated HOF-iPSC
colonies on SNL feeder cells.

Fig. 3

Figs. 3 a–f
QRT-PCR analysis of the
expression of six pluripotencyrelated genes in HOF-iPSCs:
(a) OCT3/4,
(b) NANOG,
(c) SOX2,
(d) C-MYC,
(e) TERT
and (f) KLF4. KhES-1 cells
(passage 23) were used as the
positive control and HOFs
(passage 6) as the negative
control.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 31

[32] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

based on increased proliferation and stability of
the ESC-like morphology. Expression of the
ESC-speciﬁc surface markers SSEA-3, SSEA-4
and TRA-1-60 in HOF-iPSCs was analyzed using
ﬂow cytometry; all three markers were expressed
(Fig. 4). HOF-iPSCs could be maintained beyond
20 passages and still demonstrated ESC-like
morphology. In addition, HOF-iPSCs expressed
ESC-speciﬁc surface markers, such as OCT3/4,
SSEA-4, TRA-1-60 and TRA-1-81 (Fig. 5). Tumor
formation was observed three months after the
injection of HOF-iPSCs under the epidermal
space in the neck of immunodeﬁcient mice. Histological examination showed that the tumor
contained various tissues, including cartilage
(mesoderm), melanocytes (ectoderm), gut-like
tube tissue (endoderm) and neural tissue (ectoderm; Fig. 6). Karyotype analysis of the tested
clones showed a normal human karyotype
(Fig. 7).

Discussion
Many strategies have been proposed for the
management of large defects in oral tissue or
organs such as due to congenital abnormalities,
trauma or cancer treatment. Autogenous bone
grafts are the gold standard for such reconstruction because of their osteoconductive, osteoinductive and nonimmunogenic properties. 20, 21
Recently, cell therapy using stem cells combined
with osteoconductive biomaterials or scaffolds
has become a promising alternative to autogenous bone grafts.22 In order for cell therapy to
efficiently treat large defects in oral tissue or
organs, it is important to produce a sufficient
number of cells that function similarly to primary islets. IPSCs, referred to as pluripotent stem
cells, have been generated via retrovirus-mediated introduction of four transcription factors3,
4
and represent a potentially unlimited source of
cells. IPSCs that can be efficiently generated
from tissue easily accessible to dentists have
great potential;23 iPSCs have been generated
from various oral mesenchymal cells23 and these
cells have been reported to possess higher
reprogramming efficiency than skin ﬁbroblasts
do.10
Oral mucosal tissue is easily accessible and
can be harvested by a simple and safe procedure. Oral mucosal wounds are characterized by
rapid re-epithelialization and remodeling and are
known to heal quickly compared with other skin
injuries. This rapid re-epithelialization and remo32 Volume 2 | Issue 2/2016

deling is due to the increased production of active MMP-2 in oral mucosal ﬁbroblasts compared
with skin ﬁbroblasts; MMP-2 may play an important role in rapid extracellular matrix reorganization and scarless wound healing.13, 24, 25 Therefore,
we hypothesized that HOFs generated from patient tissue might provide a superior cell source
for iPSCs. In the present study, we found that the
endogenous expression level of KLF4 was higher
in HOFs than in ESCs or HOF-iPSCs. Endogenous
KLF4 has been shown to be expressed in gingival
and periodontal fibroblasts derived from oral
tissue.12 Miyoshi et al. also found that HOFs express not only KLF4 and C-MYC but also NANOG
and OCT4 at low levels, suggesting that HOFs
possess a number of epigenetic advantages for
reprogramming.13
Integrating virus-associated genotoxicity and
tumor formation in iPSCs is of concern for clinical
application.15 Integration-free human iPSCs have
been generated using several methods.24, 26–30
Okita et al. used two of their ﬁndings to improve
reprogramming efficiency using episomal plasmids;15 iPSC generation is markedly enhanced by
p53 suppression31 and L-MYC is more potent and
speciﬁc than C-MYC during human iPSC generation.32 In our previous study,17 iPSCs were generated from HGFs using the above-mentioned
method. The generated iPSCs expressed ESC-speciﬁc markers, as assessed by gene analysis and
immunocytochemistry. Embryoid bodies and
teratomas were formed from the iPSCs, demonstrating their ability to differentiate into three
germ layers. However, 50 ESC-like colonies were
obtained only 30 days post-HGF transfection.
This lengthy reprogramming process (up to one
month) is comparable to that of the standard
virus-mediated methodology.33
The maternal Gli-like transcription factor Glis1
is highly expressed in unfertilized eggs and onecell-stage embryos.18 Maekawa et al. showed that
Glis1, but not C-MYC, increased iPSC tumorigenicity and markedly enhanced the generation of
iPSCs from both mouse and human ﬁbroblasts
when expressed together with OCT3/4, SOX2 and
KLF4.18 In the present study, we observed 50 colonies of human ES-like cells as early as 20 days
after initial episomal plasmid vector transduction.
These results demonstrate that Glis1 enhances
the efficiency of iPSC generation using episomal
plasmid vectors expressing OCT3/4, shRNA
against p53, SOX2, KLF4, L-MYC and LIN28.
However, iPSC generation from multiple donors
will be required to establish the application of iPSC
technology to biomedical research.

Journal of
Oral Science & Rehabilitation

[33] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Fig. 4

Figs. 4a–c

Fig. 5

Flow cytometry analysis
of pluripotent markers in
HOF-iPSCs:
(a) SSEA-3,
(b) SSEA-4
and (c) TRA-1-60.
Figs. 5a–d
Generated HOF-iPSCs
stained for
(a) OCT3/4,
(b) SSEA-4,
(c) TRA-1-60
and (d) TRA-1-81;
scale bar = 100 μm.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 33

[34] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

Figs. 6a–c

Fig. 7

Figs. 6a–c
IPSCs have the potential to
differentiate into three germ
layers in vivo. Hematoxylin
and eosin staining of
teratomas derived from iPSCs
at passage 20 revealed the
presence of (a) cartilage
(mesoderm; red arrow),
melanocytes (ectoderm; black
arrow), (b) gut-like tube tissue
(endoderm; red arrow) and
(c) neural tissue (ectoderm;
red arrow).
Fig. 7
Karyotype analysis of iPSCs at
passage 20 using G-band
staining.

Conclusion

Competing interests

Oral mucosal tissue can be conveniently obtained
using a simple and safe procedure and possesses epigenetic advantages for reprogramming. We
have successfully established a technique for
rapidly and safely generating human iPSCs from
oral mucosa using episomal plasmid vectors expressing OCT3/4, shRNA against p53, SOX2,
KLF4, L-MYC, LIN28 and Glis1. In order to repair
large bone defects caused by trauma, tumors or
congenital deﬁciency, it is necessary to combine
sufficient cell numbers and biomaterials. The
accelerated generation of integration-free human
iPSCs would facilitate the application of clinical-grade iPSC technology for the treatment of
large oral tissue or organ defects.

The authors declare that they have no competing
interests.

34 Volume 2 | Issue 2/2016

Acknowledgments
We wish to thank Takako Yamamoto of the Foundation for Biomedical Research and Innovation
for her support with ﬂow cytometry analysis. This
study was supported by a MEXT/JSPS KAKENHI
grant (No. 25463041).

Journal of
Oral Science & Rehabilitation

[35] => JOSR_2_A4.qxp_Layout 1

Human induced pluripotent stem cells from human oral mucosa

References
1.
Lowry WE, Richter L, Yachechko R, Pyle
AD, Tchieu J, Sridharan R, Clark AT, Plath
K. Generation of human induced
pluripotent stem cells from dermal
ﬁbroblasts.
→ Proc Natl Acad Sci U S A.
2008 Feb;105(8):2883–8.

10.
Tamaoki N, Takahashi K, Tanaka T, Ichisaka
T, Aoki H, Takeda-Kawaguchi T, Iida K,
Kunisada T, Shibata T, Yamanaka S, Tezuka
K. Dental pulp cells for induced pluripotent
stem cell banking.
→ J Dent Res.
2010 Aug;89(8):773–8.

2.
Park IH, Zhao R, West JA, Yabuuchi A, Huo
H, Ince TA, Lerou PH, Lensch MW, Daley
GQ. Reprogramming of human somatic
cells to pluripotency with deﬁned factors.
→ Nature.
2008 Jan;451(7175):141–6.

11.
Egusa H, Okita K, Kayashima H, Yu G,
Fukuyasu S, Saeki M, Matsumoto T,
Yamanaka S, Yatani H. Gingival ﬁbroblasts
as a promising source of induced
pluripotent stem cells.
→ PLoS One.
2010 Sep;5(9):e12743.

3.
Takahashi K, Tanabe K, Ohnuki M, Narita
M, Ichisaka T, Tomoda K, Yamanaka S.
Induction of pluripotent stem cells from
adult human ﬁbroblasts by deﬁned
factors.
→ Cell.
2007 Nov;131(5):861–72.
4.
Takahashi K, Yamanaka S. Induction of
pluripotent stem cells from mouse
embryonic and adult ﬁbroblast cultures by
deﬁned factors.
→ Cell.
2006 Aug;126(4):663–76.
5.
Yu J, Vodyanik MA, Smuga-Otto K,
Antosiewicz-Bourget J, Frane JL, Tian S,
Nie J, Jonsdottir GA, Ruotti V, Stewart R,
Slukvin II, Thomson JA. Induced
pluripotent stem cell lines derived from
human somatic cells.
→ Science.
2007 Dec;318(5858):1917–20.
6.
Evans MJ, Kaufman MH. Establishment in
culture of pluripotential cells from mouse
embryos.
→ Nature.
1981 Jul;292(5819):154–6.
7.
Martin GR. Isolation of a pluripotent cell
line from early mouse embryos cultured in
medium conditioned by teratocarcinoma
stem cells.
→ Proc Natl Acad Sci U S A.
1981 Dec;78(12):7634–8.
8.
Thomson JA, Itskovitz-Eldor J, Shapiro SS,
Waknitz MA, Swiergiel JJ, Marshall VS,
Jones JM. Embryonic stem cell lines
derived from human blastocysts.
→ Science.
1998 Nov;282(5391):1145–7.
9.
Su RJ, Neises A, Zhang XB. Generation of
iPS cells from human peripheral blood
mononuclear cells using episomal vectors.
In: Turksen K, Nagy A, editors. Induced
pluripotent stem (iPS) cells: methods and
protocols.
→ New York: Springer;
2016. p. 57–69. (Walker JM, editor.
Methods in molecular biology; vol. 1357).

12.
Wada N, Wang B, Lin NH, Laslett AL,
Gronthos S, Bartold PM. Induced
pluripotent stem cell lines derived from
human gingival ﬁbroblasts and periodontal
ligament ﬁbroblasts.
→ J Periodontal Res.
2011 Aug;46(4):438–47.
13.
Miyoshi K, Tsuji D, Kudoh K, Satomura K,
Muto T, Itoh K, Noma T. Generation of
human induced pluripotent stem cells
from oral mucosa.
→ J Biosci Bioeng.
2010 Sep;110(3):345–50.
14.
Oda Y, Yoshimura Y, Ohnishi H, Tadokoro
M, Katsube Y, Sasao M, Kubo Y, Hattori K,
Saito S, Horimoto K, Yuba S, Ohgushi H.
Induction of pluripotent stem cells from
human third molar mesenchymal stromal
cells.
→ J Biol Chem.
2010 Sep;285(38):29270–8.
15.
Okita K, Matsumura Y, Sato Y, Okada A,
Morizane A, Okamoto S, Hong H,
Nakagawa M, Tanabe K, Tezuka K, Shibata
T, Kunisada T, Takahashi M, Takahashi J,
Saji H, Yamanaka S. A more efficient
method to generate integration-free
human iPS cells.
→ Nat Methods.
2011 May;8(5):409–12.
16.
Su RJ, Baylink DJ, Neises A, Kiroyan JB,
Meng X, Payne KJ, Tschudy-Seney B, Duan
Y, Appleby N, Kearns-Jonker M, Gridley
DS, Wang J, Lau KH, Zhang XB. Efficient
generation of integration-free iPS cells
from human adult peripheral blood using
BCL-XL together with Yamanaka factors.
→ PLoS One.
2013 May;8(5):e64496.
17.
Umezaki Y, Hashimoto Y, Nishishita N,
Kawamata S, Baba S. Human gingival
integration-free iPSCs; a source for
MSC-like cells.
→ Int J Mol Sci.
2015 Jun;16(6):13633–48.

18.
Maekawa M, Yamaguchi K, Nakamura T,
Shibukawa R, Kodanaka I, Ichisaka T,
Kawamura Y, Mochizuki H, Goshima N,
Yamanaka S. Direct reprogramming of
somatic cells is promoted by maternal
transcription factor Glis1.
→ Nature.
2011 Jun;474(7350):225–9.
19.
Livak KJ, Schmittgen TD. Analysis of
relative gene expression data using
real-time quantitative PCR and the
2− ΔΔCT method.
→ Methods.
2001 Dec;25(4):402–8.
20.
Gimbel M, Ashley RK, Sisodia M, Gabbay
JS, Wasson KL, Heller J, Wilson L,
Kawamoto HK, Bradley JP. Repair of
alveolar cleft defects: reduced morbidity
with bone marrow stem cells in a
resorbable matrix.
→ J Craniofac Surg.
2007 Jul;18(4):895–901.
21.
Sakamoto F, Hashimoto Y, Kishimoto N,
Honda Y, Matsumoto N. The utility of
human dedifferentiated fat cells in bone
tissue engineering in vitro.
→ Cytotechnology.
2015 Jan;67(1):75–84.
22.
Levi B, Glotzbach JP, Wong VW, Nelson
ER, Hyun J, Wan DC, Gurtner GC,
Longaker MT. Stem cells: update and
impact on craniofacial surgery.
→ J Craniofac Surg.
2012 Jan;23(1):319–22.
23.
Egusa H, Sonoyama W, Nishimura M,
Atsuta I, Akiyama K. Stem cells in
dentistry—part I: stem cell sources.
→ J Prosthodont Res.
2012 Jul;56(3):151–65.
24.
Zhou W, Freed CR. Adenoviral gene
delivery can reprogram human ﬁbroblasts
to induced pluripotent stem cells.
→ Stem Cells.
2009 Nov;27(11):2667–74.
25.
Stephens P, Davies KJ, Occleston N, Pleass
RD, Kon C, Daniels J, Khaw PT, Thomas
DW. Skin and oral ﬁbroblasts exhibit
phenotypic differences in extracellular
matrix reorganization and matrix
metalloproteinase activity.
→ Br J Dermatol.
2001 Feb;144(2):229–37.

27.
Jia F, Wilson KD, Sun N, Gupta DM, Huang
M, Li Z, Panetta NJ, Chen ZY, Robbins RC,
Kay MA, Longaker MT, Wu JC. A nonviral
minicircle vector for deriving human iPS
cells.
→ Nat Methods.
2010 Mar;7(3):197–9.
28.
Warren L, Manos PD, Ahfeldt T, Loh YH, Li
H, Lau F, Ebina W, Mandal PK, Smith ZD,
Meissner A, Daley GQ, Brack AS, Collins JJ,
Cowan C, Schlaeger TM, Rossi DJ. Highly
efficient reprogramming to pluripotency
and directed differentiation of human cells
with synthetic modiﬁed mRNA.
→ Cell Stem Cell.
2010 Nov;7(5):618–30.
29.
Kim D, Kim CH, Moon JI, Chung YG, Chang
MY, Han BS, Ko S, Yang E, Cha KY, Lanza R,
Kim KS. Generation of human induced
pluripotent stem cells by direct delivery of
reprogramming proteins.
→ Cell Stem Cell.
2009 Jun;4(6):472–6.
30.
Fusaki N, Ban H, Nishiyama A, Saeki K,
Hasegawa M. Efficient induction of
transgene-free human pluripotent stem
cells using a vector based on Sendai virus,
an RNA virus that does not integrate into
the host genome.
→ Proc Jpn Acad Ser B Phys Biol Sci.
2009;85(8):348–62.
31.
Hong H, Takahashi K, Ichisaka T, Aoi T,
Kanagawa O, Nakagawa M, Okita K,
Yamanaka S. Suppression of induced
pluripotent stem cell generation by the
p53-p21 pathway.
→ Nature.
2009 Aug;460(7259):1132–5.
32.
Nakagawa M, Takizawa N, Narita M,
Ichisaka T, Yamanaka S. Promotion of
direct reprogramming by transformation-deﬁcient Myc.
→ Proc Natl Acad Sci U S A.
2010 Aug;107(32):14152–7.
33.
Shimada H, Hashimoto Y, Nakada A,
Shigeno K, Nakamura T. Accelerated
generation of human induced pluripotent
stem cells with retroviral transduction and
chemical inhibitors under physiological
hypoxia.
→ Biochem Biophys Res Commun.
2012 Jan;417(2):659–64.

26.
Woltjen K, Michael IP, Mohseni P, Desai R,
Mileikovsky M, Hämäläinen R, Cowling R,
Wang W, Liu P, Gertsenstein M, Kaji K,
Sung HK, Nagy A. piggyBac transposition
reprograms ﬁbroblasts to induced
pluripotent stem cells.
→ Nature.
2009 Apr;458(7239):766–70.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 35

[36] => JOSR_2_A4.qxp_Layout 1

Bone block graft to treat apicomarginal defect

Bone block graft to treat
an apicomarginal defect
simultaneously with apical
surgery of the maxillary
incisors: A case report with
three-year follow-up

Abstract
Objective
Juan Cervera Ballester,a David Peñarrocha Oltra,a
María Peñarrocha Diago,a Laura Maestre Ferrína
& Miguel Peñarrocha Diagoa
a

Department of Stomatology, Faculty of Medicine and
Odontology, University of Valencia, Valencia, Spain

Corresponding author:
Dr. David Peñarrocha Oltra
Cirugía Bucal. Clínicas Odontológicas
C/Gascó Oliag, 1
46021 Valencia
Spain
T +34 963 86 4144
david.penarrocha@uv.es
How to cite this article:
Cervera Ballester J, Peñarrocha Oltra D, Peñarrocha Diago
M, Maestre Ferrín L, Peñarrocha M. Bone block graft to treat
an apicomarginal defect simultaneously with apical surgery
of the maxillary incisors: a case report with three-year
follow-up.
J Oral Science Rehabilitation.
2016 Jun;2(2):36–40.

The objective of this article is to describe the successful management of
an apicomarginal defect of a maxillary lateral incisor with a bone block
graft performed simultaneously with apical surgery of both lateral and
central incisors.
Case presentation

A 15-year-old male patient with a recurrent sinus tract involving the maxillary right incisors was referred for possible treatment with apical surgery.
Root canal treatment and apical surgery had been undertaken unsuccessfully one year before. Radiographic examination revealed a radiolucent
area surrounding the tooth apexes. A bone block was harvested from the
apical area of the central incisor with ultrasound tips to gain access to the
root end and apical surgery of both incisors was performed. The bone block
graft was used to cover an apicomarginal bony defect of the maxillary
lateral incisor. At the three-year follow-up, the teeth had no clinical signs
or symptoms, and the periapical radiograph demonstrated complete healing around the apexes.
Conclusion

The use of a bone block graft to treat an apicomarginal defect in conjunction with apical surgery achieved complete healing of the periradicular
tissue in this case.
Keywords

Apicomarginal defect, apical surgery, bone regeneration.
36 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[37] => JOSR_2_A4.qxp_Layout 1

Bone block graft to treat apicomarginal defect

Introduction
An apicomarginal defect is deﬁned as a localized
bony defect that is characterized by the absence
of alveolar bone over the entire root length.1 This
type of defect signiﬁcantly reduces the prognosis
of periapical surgery. Hirsch et al.2 and Skoglund
and Persson3 observed healing rates of 27% and
37%, respectively, in teeth that had undergone
periapical surgery and with apicomarginal
defects, substantially lower than teeth in which
the vestibular cortical was intact. Current surgical techniques, supported by the use of ultrasound, ampliﬁcation and magniﬁcation devices,
have improved the prognosis of periapical surgery,4 also in teeth with this type of bony defect.
Kim et al. observed a healing success of 77.5% in
teeth with apicomarginal defects using a microsurgical technique, but still signiﬁcantly lower
than the 95.2% rate of teeth with lesions conﬁned to the apical area.5
The reason for the poorer prognosis in teeth
with apicomarginal defects has been suggested
to be the formation of a long junctional epithelium over the denuded root surface, preventing
bone regeneration.6 Experimental7, 8 and clinical
studies9 have shown signiﬁcantly higher success
rates with the use of tissue regeneration
techniques (guided tissue regeneration, GTR) in
apicomarginal defects.
The purpose of this article is to describe the
successful management of an apicomarginal
defect of a maxillary lateral incisor with a bone
block graft performed simultaneously with
apical surgery of both lateral and central incisors.

Case report
A 15-year-old male patient was referred to our
clinic because of a recurrent sinus tract involving
the maxillary right incisors (Fig. 1). Regarding the
patient’s medical history, no health problem was
reported, nor was a history of allergies or the use
of any medication. The patient had suffered a
traumatism one year before that caused fracturing of the central incisors and the right lateral
incisor. The central incisors were restored with
composite and root canal ﬁllings were performed
in both central and lateral right incisors; in addition, root resection of the lateral incisor had been
performed without retrograde ﬁlling. The periapical radiograph showed a radiolucent area surrounding the tooth apex (Fig. 2). Probing depth
was normal around the central incisor and the

lateral incisor had a 7 mm depth at the vestibular
aspect.
The surgical treatment combined two procedures: endodontic surgery of both maxillary right
incisors and a bone autograft to regenerate the
buccal bone plate of the lateral incisor. The
surgery was carried out under local anesthesia
with 4% articaine and 1:100,000 epinephrine
(Inibsa, Lliçà de Vall, Spain). After elevation of a
full-thickness mucoperiosteal ﬂap, the pathological tissue around the apex of the lateral incisor
was debrided. Afterward, a bone block was harvested from the apical area of the central incisor
with ultrasound tips to gain access to the root
end (Fig. 3); the block was kept submerged in
saline solution. The root of the central incisor was
then resected approximately 3 mm from the apex;
the lateral incisor root had been resected in a
previous periapical surgery (Fig. 4). Hemostasis
of the bony crypt was achieved with aluminum
chloride (Expasyl, Produits Dentaires Pierre
Rolland, Merignac, France).10 The root ends were
inspected using a rigid endoscope (Möller-Wedel,
Munich, Germany; Figs. 5 & 6). The root-end cavities were prepared with sonic-driven microtips
(Piezon Master 400, EMS Electro Medical Systems, Nyon, Switzerland; Fig. 7) and were retrofilled with mineral trioxide aggregate (MTA;
DENTSPLY Tulsa Dental Specialties, Tulsa, Okla.,
U.S.; Fig. 8). The quality of the retrograde ﬁllings
was inspected with the endoscope (Fig. 9). The
bone block graft was ﬁxed with an osteosynthesis screw to regenerate the buccal wall of the
lateral incisor (Fig. 10). The bony defect at the
donor area and the apical area of tooth #12 were
covered with textured bovine collagen (Lyostypt,
B. Braun Melsungen, Tuttlingen, Germany). After
cleaning the wound area, primary wound closure was accomplished with multiple interrupted
sutures.
The patient was prescribed amoxicillin
(500 mg/8 h) preoperatively (two days before
surgery) for suppurative abscess and ﬁve days
after intervention owing to the bone block graft
procedure, ibuprofen (400 mg/8 h for four days),
a 0.12% chlorhexidine rinse (t.i.d. for seven days)
and paracetamol (500 mg on demand) in the
event of intense pain. The sutures were removed
after one week.
At the follow-up visit after three years, the
teeth were asymptomatic, no gingival recession
had occurred and normal periodontal probing
depths were recorded around both teeth (Fig. 11).
The periapical radiograph showed complete bone
regeneration around the apexes (Fig. 12).

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 37

[38] => JOSR_2_A4.qxp_Layout 1

Bone block graft to treat apicomarginal defect

Figs. 1 & 2

Fig. 1
Sinus tract involving the
maxillary right incisors.
Fig. 2
The periapical radiograph
shows a radiolucency around
the apexes of the central and
lateral incisors.
Fig. 3
Using ultrasound, a bone block
was harvested from the apical
area of the central incisor.
Fig. 4
Intraoperative image after
root-end resection.
Fig. 5
Endoscopic image of the
lateral incisor apex, resected
during a previous periapical
surgery.

Figs. 3 & 4

Fig. 6
Endoscopic image of the
central incisor apex after
root-end resection, showing
the gutta-percha.
Fig. 7
Root-end cavities prepared
in both teeth.
Figs. 5 & 6

Fig. 8
Image after root-end cavity
ﬁlling. The apicomarginal
defect of the lateral incisor is
evident over the entire buccal
bone plate.

Figs. 7 & 8

38 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[39] => JOSR_2_A4.qxp_Layout 1

Bone block graft to treat apicomarginal defect

Fig. 9

observed that GTR improved the success rate of
periapical surgery, particularly in large and
through-and-through lesions, although the differences were not statistically signiﬁcant.15 However, none of the studies included evaluated the
prognosis of teeth with apicomarginal defects.
Tissue regeneration in teeth with apicomarginal
defects is not as predictable and there is no veriﬁed treatment option.16 Only four clinical trials,
none of them with control groups, were found in
which the prognosis of periapical surgery in teeth
with apicomarginal lesions was studied. Dietrich
et al. grafted the defects with inorganic bovine
bone material and a collagen membrane.17 After
one year, the clinical and radiographic assessment demonstrated a success rate of 82.6% and
the median probing pocket depth decreased from
9 mm to 3 mm. Three years later, Marín-Botero
et al. found similar results in two study groups.9
In one group, a polyglactin 910 membrane was
placed over the apicomarginal defect (n = 15), and
in the other group, a sliding periosteal graft was
used to cover the defect (n = 15). Identical success
rates of 87% were observed in both groups.
Recently, the outcome of modern endodontic microsurgery was evaluated by Kim et al. in a
prospective study.5 They studied healing according to the type of lesion and observed a healing
success rate of 73.7% for teeth with apicomarginal defects treated with calcium sulfate placed
into the periradicular bony defect and a collagen
membrane covering the denuded buccal surface.
Goyal et al. evaluated the use of platelet-rich
plasma (PRP) for the treatment of apicomarginal

Fig. 10

Fig. 11

Fig. 9
Endoscopic image after cavity
ﬁlling with MTA.
Fig. 10
The bone block graft was ﬁxed
with an osteosynthesis screw
to regenerate the buccal wall
of the lateral incisor.
Fig. 11
Clinical appearance at the
three-year follow-up visit.

Fig. 12
Periapical radiograph three
years after surgery. Complete
bone regeneration around
the apexes was observed.

Discussion
Complete healing of periapical tissue after periapical surgery includes regeneration of the alveolar bone, periodontal ligament and cementum.11
Several studies have shown that GTR applied with
periapical surgery promotes healing of apical lesions and improves the prognosis of the treatment.12–14 In a recent meta-analysis, Tsesis et al.
Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 39

[40] => JOSR_2_A4.qxp_Layout 1

Bone block graft to treat apicomarginal defect

defects.18 They conducted a study with three
groups: In the ﬁrst group, the defect was covered with a collagen membrane (n = 10); in the
second group, a PRP preparation was placed over
the defect (n = 10); and in the last group, PRP was
packed into the defect and a collagen sponge was
used to cover it (n = 10). The overall rate of healed
cases was 80.76%, with differences that were
not statistically signiﬁcant between the groups.
Currently, the use of ultrasound, ampliﬁcation
and magniﬁcation devices has improved the prognosis of periapical surgery.4 In this case report,
these advances allowed treatment of an apicomarginal defect with a bone block graft after periapical surgery of two maxillary incisors. There
are no studies in the literature on the use of a block
graft to treat this type of lesion simultaneously
with apical surgery. Bone block grafts are used in
implantology owing to osteogenic, osteoinductive
and osteoconductive potential. Thus, although
there are currently very few studies that provide
scientiﬁc evidence sufficient to determine the ideal
treatment of apicomarginal defects, we believe

that the procedure proposed in this article can be
an alternative for the treatment of these defects.
One of the main problems with this type of
graft is management of the soft tissue, since in
order to minimize the risk of dehiscence, it is
necessary to achieve a tension-less wound closure.19 The stabilization and intimate contact
between the block graft and the recipient bed
have been considered crucial to a successful outcome.20 This can be achieved with the use of
osteosynthesis screws.21
Conclusion
The use of a bone block graft to treat an apicomarginal defect in conjunction with apical surgery
achieved complete healing of the periradicular
tissue in this case.
Competing interests
The authors declare that they have no competing
interests.

References
1.
Dietrich T, Zunker P, Dietrich D,
Bernimoulin JP. Apicomarginal defects
in periradicular surgery: classiﬁcation
and diagnostic aspects.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
2002 Aug;94(2):233–9.

7.
Douthitt JC, Gutmann JL, Witherspoon DE.
Histologic assessment of healing after
the use of a bioresorbable membrane
in the management of buccal bone loss
concomitant with periradicular surgery.
→ J Endod.
2001 Jun;27(6):404–10.

12.
Taschieri S, del Fabbro M, Testori T,
Weinstein R. Efficacy of xenogeneic bone
grafting with guided tissue regeneration
in the management of bone defects after
surgical endodontics.
→ J Oral Maxillofac Surg.
2007 Jun;65(6):1121–7.

2.
Hirsch JM, Ahlström U, Henrikson PA,
Heyden G, Peterson, LE. Periapical surgery.
→ Clin Implant Dent Relat Res.
1979 Jun;8(3):173–85.

8.
Britain SK, von Arx T, Schenk RK, Buser D,
Nummikoski P, Cochran DL. The use of
guided tissue regeneration principles in
endodontic surgery for induced chronic
periodontic-endodontic lesions: a clinical,
radiographic, and histologic evaluation.
→ J Periodontol.
2005 Mar;76(3):450–60.

13.
Taschieri S, Del Fabbro M, Testori T, Saita
M, Weinstein R. Efficacy of guided tissue
regeneration in the management of
through-and-through lesions following
surgical endodontics: a preliminary study.
→ Int J Periodontics Restorative Dent.
2008 Jun;28(3):265–71.

3.
Skoglund A, Persson G. A follow-up
study of apicoectomized teeth with total
loss of the buccal bone plate.
→ Oral Surg Oral Med Oral Pathol.
1985 Jan;59(1):78–81.
4.
Kim S, Kratchman S. Modern endodontic
surgery concepts and practice: a review.
→ J Endod.
2006 Jul;32(7):601–23.
5.
Kim E, Song JS, Jung IY, Lee SJ, Kim S.
Prospective clinical study evaluating
endodontic microsurgery outcomes for
cases with lesions of endodontic origin
compared with cases with lesions of
combined periodontal-endodontic origin.
→ J Endod.
2008 May;34(5):546–51.
6.
Rankow HJ, Krasner PR. Endodontic
applications of guided tissue regeneration
in endodontic surgery.
→ J Endod.
1996 Jan;22(1):34–43.

9.
Marín-Botero ML, Domínguez-Mejía JS,
Arismendi-Echavarría JA, Mesa-Jaramillo
AL, Flórez-Moreno GA, Tobón-Arroyave SI.
Healing response of apicomarginal defects
to two guided tissue regeneration
techniques in periradicular surgery:
a double-blind, randomized-clinical trial.
→ Int Endod J.
2006 May;39(5):368–77.
10.
Von Arx T, Jensen SS, Hänni S, Schenk RK.
Haemostatic agents used in periradicular
surgery: an experimental study of their
efficacy and tissue reactions.
→ Int Endod J.
2006 Oct;39(10):800–8.
11.
Lin L, Chen MY, Ricucci D, Rosenberg PA.
Guided tissue regeneration in periapical
surgery.
→ J Endod.
2010 Apr;36(4):618–25.

40 Volume 2 | Issue 2/2016

14.
Pecora G, De Leonardis D, Ibrahim N, Bovi
M, Cornelini R. The use of calcium sulphate
in the surgical treatment of a ‘through and
through’ periradicular lesion.
→ Int Endod J.
2001 Apr;34(3):189–97.
15.
Tsesis I, Rosen E, Tamse A, Taschieri S, Del
Fabbro M. Effect of guided tissue
regeneration on the outcome of surgical
endodontic treatment: a systematic review
and meta-analysis.
→ J Endod.
2011 Aug;37(8):1039–45.
16.
Von Arx T, AlSaeed M. The use of
regenerative techniques in apical surgery:
a literature review.
→ Saudi Dent J.
2011 Jul;23(3):113–27.

Journal of
Oral Science & Rehabilitation

17.
Dietrich T, Zunker P, Dietrich D, Bernimoul
in JP. Periapical and periodontal healing
after osseous grafting and guided tissue
regeneration treatment of apicomarginal
defects in periradicular surgery: results
after 12 months.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
2003 Apr;95(4):474–82.
18.
Goyal B, Tewari S, Duhan J, Sehgal PK.
Comparative evaluation of platelet-rich
plasma and guided tissue regeneration
membrane in the healing of apicomarginal
defects: a clinical study.
→ J Endod.
2011 Jun;37(6):773–80.
19.
Felice P, Pellegrino G, Checchi L, Pistilli R,
Esposito M. Vertical augmentation with
interpositional blocks of anorganic bovine
bone vs. 7-mm-long implants in posterior
mandibles: 1-year results of a randomized
clinical trial.
→ Clin Oral Implants Res.
2010 Dec;21(12):1394–403.
20.
De Carvalho PS, Vasconcellos LW, Pi J.
Inﬂuence of bed preparation on the
incorporation of autogenous bone grafts:
a study in dogs.
→ Int J Oral Maxillofac Implants.
2000 Jul-Aug;15(4):565–70.
21.
Buser D, Dula K, Hirt HP, Schenk RK.
Lateral ridge augmentation using
autografts and barrier membranes:
a clinical study with
40 partially edentulous patients.
→ J Oral Maxillofac Surg.
1996 Apr;54(4):420–32.

[41] => JOSR_2_A4.qxp_Layout 1

register for

FREE

– education everywhere
and anytime
– live and interactive webinars
– more than 1,000 archived courses
– a focused discussion forum
– free membership
– no travel costs
– no time away from the practice
– interaction with colleagues and
experts across the globe
– a growing database of
scientific articles and case reports
– ADA CERP-recognized
credit administration

www.DTStudyClub.com

Dental Tribune Study Club

Join the largest
educational network
in dentistry!
ADA CERP is a service of the American Dental Association to assist dental professionals in identifying quality providersof continuing dental education.
ADA CERP does not approve or endorse individual courses or instructors, nor does it imply acceptance of credit hours by boards of dentistry.

[42] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

Composition of platelet-rich
plasma gel:
A Western blot analysis

Abstract
Objective
Pablo Galindo Moreno,a Gustavo Avila Ortiz,b
Laura Torrecillas Martinez,a Juan Emilio
Fernández Barbero,c Francisco O’Valled & Hom-Lay Wange
a

Oral Surgery and Implant Dentistry Department, School
of Dentistry, University of Granada, Granada, Spain
b
Department of Periodontics, College of Dentistry,
University of Iowa, Iowa City, Iowa, U.S.
c
Human Anatomy and Embryology Department, School
of Medicine, University of Granada, Granada, Spain
d
Pathology Department, School of Medicine, and Institute
of Biopathology and Regenerative Medicine, University
of Granada, Granada, Spain
e
Department of Periodontics and Oral Medicine, School of
Dentistry, University of Michigan, Ann Arbor, Mich., U.S.
Corresponding author:
Dr. Pablo Galindo Moreno
C/ Recogidas, 39 5º Izq
18005 Granada
Spain

Platelet-rich plasma (PRP) gel is an autogenous blood-derived material
that may be used as a regenerative agent of oral structures. The regenerative capacity of PRP is largely attributed to its composition, including
many different growth factors. Thus far, no study has identiﬁed the molecular content of this gel. Therefore, it was the purpose of this study to
assess the presence of different growth factors in PRP gel, using the Western blot technique.
Materials and methods

Blood samples were collected from 20 healthy donors and then processed
to obtain PRP gel samples. The Western blot technique was used to determine the presence of the following growth factors: vascular endothelial
growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-beta (TGF-Ƶ1), ﬁbroblast growth factor (FGF), insulinlike growth factor-1 (IGF-1) and epidermal growth factor (EGF).
Results

T +34 958 52 0658
F +34 958 52 0658
pgalindo@ugr.es
How to cite this article:

Western blot analysis showed positive electrophoretic bands corresponding to molecular weights of the examined platelet growth factors. These
bands were observed in every sample of PRP, demonstrating their presence
as constituents of PRP gel.

Galindo Moreno P, Avila Ortiz G, Torrecillas Martinez L,
Fernández Barbero JE, O’Valle F, Wang HL. Composition
of platelet-rich plasma gel: a Western blot analysis.

Conclusion

Data from our study showed that PRP gel contains varying amounts of
VEGF, TGF-Ƶ1, bFGF, PDGF-A, IGF-1 and EGF.

J Oral Science Rehabilitation.
2016 Jun;2(2):42–8.

Keywords

Platelet-rich plasma, growth factors, tissue engineering, wound healing,
Western blotting.
42 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[43] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

Introduction
Tissue integrity and blood vessel repair are essential after destructive and reconstructive
events, such as surgery, trauma and regenerative
procedures. The seeking for and identiﬁcation of
reliable and safe techniques or therapeutic methods that would predictably enhance the regenerative capacity in damaged tissue has become
a major focus of current research. A large number
of cells are involved in wound healing, including
platelets, which play a crucial role in controlling
coagulation and releasing growth factors and
cytokines related to tissue regeneration. Platelet-derived products isolated from the patient’s
own blood have been extensively studied and
tested because platelets are considered a source
of cytokines and growth factors, which amplify
wound healing and tissue repair.1
Platelet-rich plasma (PRP) offers much potential owing to its autogenous nature and a
supposed molecular content. PRP was originally
deﬁned as a product with a high concentration
of platelets, obtained from autologous blood, that
contains different growth factors that may potentially inﬂuence cells involved in wound healing
and bone regeneration.2 Besides its adhesive and
hemostatic properties, from a biological standpoint, the rationale for the use of PRP is rooted
in the idea that regenerative advantages are obtained after the application of this product, given
the modulating activity that is supposed to be
exerted by molecules released from the ƴ-granules, which are stored in the cytoplasm of platelets.3, 4 A wide variety of molecules with different biological roles are known to be contained
in the different platelet granules, such as serotonin, coagulation factors, proteoglycans, membrane-associated proteins and different types of
proteases.1, 5 However, some researchers believe
that the activity of speciﬁc mitogenic/growth
factors, concretely stored in the ƴ-granules, is of
major importance in regenerative events.6, 7
Growth factors, including those that have been
classically associated with PRP, are included in a
family of polypeptides of low molecular weight
with a very short life span. Growth factors can
modulate cell behavior, alter gene expression of
target cells and ultimately lead to promotion of
cell migration, proliferation, differentiation and
eventually maturation.8 The growth factors that
have been reported to be in PRP include vascular
endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth

factor-beta (TGF-ʹ1), ﬁbroblast growth factor
(FGF), insulin-like growth factor-1 (IGF-1) and
epidermal growth factor (EGF).2, 6, 9
When PRP was introduced in dentistry, most
of the knowledge that justiﬁed its attributed
regenerative potential came from experimental
animal models10, 11 and several human case reports.12–15 Nowadays, clinical trials conducted to
assess the clinical validity of PRP have shown
controversial results, many of them advocating
for no significant effect when PRP is used
alone.16–18 However, it has been reported that the
addition of PRP to bone substitutes promotes
enhancement of osseointegration of dental implants, optimizing the expansion of new bone
cells, and improvement of the aggregation and
cohesiveness of particulate-based bone substitutes.19, 20 In order to understand how PRP works,
it is important to know its structure and molecular composition.21 It is important to know
whether the described factors are present in an
amount that can be easily detectable and in what
proportion of the population. However, only limited evidence is currently available. Hence, it
was the aim of this study to conduct a qualitative analysis to screen the molecular composition of PRP.

Materials and methods
Preparation of PRP

Venous blood was obtained from 20 healthy volunteers (16 males and four females; mean age of
27.4), who gave their informed consent and met
the following inclusion criteria after a complete
medical history recording and examination: no
medication taken in the last two weeks, no
dental or intra-oral surgical treatment within the
last month, and no vaccine received and no infection history within the last three months.
Brieﬂy, 20 cm3 of blood was drawn per patient
and 5 cm3 placed into each of four Vacutainer
tubes (Becton Dickinson, Oxford, U.K.), which
contained 0.1 cm3 of 3.8% (w/v) sodium citrate.
In order to minimize platelet activation during
blood collection, a 19-gauge butterﬂy needle with
a light tourniquet was used and the ﬁrst 2 mL of
blood was discarded. For the preparation of the
PRP, a modiﬁcation of the original procedure proposed by Anitua in 1999 was followed.4 Immediately after collection, the tubes were placed in a
centrifuge machine to spin at 1,500 rpm for 7 min

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 43

[44] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

Fig. 1

Fig. 1
Western blot analysis
illustrated the expression of
VEGF, TGF-ʹ1, bFGF, PDGF-A,
IGF-1 and EGF.

in order to separate the blood fractions. In order
to produce PRP, 500 mL from the volume of plasma situated just over the top of the red fraction
was collected from every sample. To each 500 mL
of plasma, 250 mL of calcium chloride was added. Finally, the tubes were placed in a 37 ºC warm
water bath for 20 min to accelerate the formation
of a PRP gel. The remaining contents of the tubes
was discarded.
Monoclonal and
polyclonal antibodies

The Western blot technique was performed using
monoclonal antibodies for the selected platelet
growth factors: anti-VEGF (C-1: sc-7269; Santa
Cruz Biotechnology, Santa Cruz, Calif., U.S.),
anti-PDGF-A (E-10; sc-9974; Santa Cruz Biotechnology), anti-human TGF-ß1 (Clone 9016.2;
Sigma-Aldrich, St. Louis, Mo., U.S.), anti-human
IGF-1 Goat (Sigma-Aldrich), anti-human bFGF
(Clone FB-8; Sigma-Aldrich) and anti-human EGF
(Clone EGF-10; Sigma-Aldrich). Fluorochrome-marked polyclonal immunoglobulin-G
antibodies able to bind the previously mentioned
antibodies were purchased from Santa Cruz Biotechnology to be used as secondary antibodies.
44 Volume 2 | Issue 2/2016

We s t e r n b l o t t e c h n i q u e

Gels for electrophoresis (12% SDS-PAGE) were
initially prepared for each experiment. Final samples consisting of a volume of 15 mL of PRP clot,
previously diluted in a sample buffer (at a proportion of 1 mg/mL), were properly identiﬁed and
placed on each well of the electrophoresis gels.
The proteins were electrophoretically run at a
rate of 60 V and 45 mA for 2 h, using the PowerPac HC electrophoresis kit (Bio-Rad, Laboratories, Hercules, Calif., U.S.). Transference of the
proteins located in the running gel was performed
using a Trans-Blot SD device (Bio-Rad), at
25 V/60 mA for 50 min. Once the transference to
nitrocellulose membranes, designed for protein
transference, had been completed, specimens
were submerged in 20 mL of blocking suspension
(5 mg of fat-free powder milk diluted in 100 mL
of 1 × TBS) for 60 min, at room temperature. After
that, the membranes were incubated with the
mentioned speciﬁc monoclonal antibodies for
different growth factors in agitation, for 24 h at
4 °C. Three 5 min washes using a washing solution (0.5 mL of 0.1% TWEEN 20 in 500 mL of
1 × TBS) were performed prior to the incubation
of the membranes with the secondary antibodies,

Journal of
Oral Science & Rehabilitation

[45] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

Table 1

Donor

VEGF
45 kDa

TGF-Ƶ1
25 kDa

bFGF
16–18 kDa

PDGF-A
15 kDa

IGF-1
7.6 kDa

EGF
6.4 kDa

JF

+

+

+

+

+

+

PG

+

+

+

+

+

+

OC

+

+

+

+

+

+

SR

+

+

+

+

+

+

JL

+

+

+

+

+

+

GA

+

+

+

+

+

+

VR

+

+

+

+

+

+

GG

+

+

+

+

+

+

MF

+

+

+

+

+

+

EM

+

+

+

+

+

+

EF

+

+

+

+

+

+

FG

+

+

+

+

+

+

IM

+

+

+

+

+

+

JS

+

+

+

+

+

+

DG

+

+

+

+

+

+

AA

+

+

+

+

+

+

RG

+

+

+

+

+

+

CF

+

+

+

+

+

+

LG

+

+

+

+

+

+

LF

+

+

+

+

+

+

for 2 h at room temperature. Finally, the membranes received three 5 min washes (0.5 mL of
0.1% TWEEN 20 in 500 mL of 1 × TBS), and they
were developed and scanned. Bands for each
sample were assessed and assigned to three levels of intensity: band not visible (–); band visible
but not solid (+/–); and solid positive band (+).

Results
In this qualitative analysis, all growth factors
under study (VEGF, PDGF-A, TGF-ʹ1, bFGF, IGF1 and EGF) were present in all of the patients
(Table 1). The bands observed as positive after
developing the membrane were located at the
presumed molecular weight for each of the factors: VEGF at 45 kDa, TGF-Ƶ1 at 25 kDa, bFGF at
17 kDa, PDGF-A at 15 kDa, IGF-1 at 7.6 kDa and
EGF at 6.4 kDa (Fig. 1).

Discussion
PRP has been suggested to be a novel agent that
could promote not only hard-tissue regeneration3
but also soft-tissue healing.22 Although controversy exists regarding its ability to promote regeneration, especially in hard tissue,17, 23, 24 many
clinicians remain loyal to its clinical usage. In
order to enhance understanding of PRP, our
research group has focused on analyzing the
structure and composition of PRP gel using ﬂow
cytometry and the scanning electron microscope.25 Our results have shown PRP’s microstructural composition, essentially constituted
by ﬁbrin in relation to the different cellular elements in the clot, identiﬁed as largely platelets
in different stages of activation.
Following the line traced by those previous
ﬁndings, our group has designed a further in vitro
study to determine the presence of different

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 45

Table 1
Expression of VEGF, TGF-Ƶ1,
bFGF, PDGF-A, IGF-1 and EGF
in the different PRP gel
samples obtained from
donors, after Western blotting.

[46] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

growth factors known to be present in the ƴ-granules of the platelets in PRP gel samples. 26
Results obtained from the present study indicate that PRP gel contains the six tested growth
factors: VEGF, PDGF, TGF-Ƶ1, FGF, IGF-1 and EGF.
These growth factors have been known for their
inﬂuence at different stages of the healing processes.8, 19 Basically, growth factors are lowweighted molecules produced and released by
many different cell types under variable stimuli
and play a determinant role in the development
and maturation of different tissues in mammals.
For instance, VEGF is an important regulator of
angiogenic processes, increasing vessel permeability and contributing essentially to neoangiogenesis. Its presence in the clot of PRP can partially justify the positive outcomes obtained in
some studies regarding the beneﬁcial effect of
PRP on capillary growth in soft-tissue wound
healing.27 Several in vitro and animal studies have
illustrated the modulating effect that growth
factors exert on different cell types. PDGF is primarily responsible for tissue healing and has been
shown to induce proliferation of gingival ﬁbroblasts and osteoblasts28 and adherence of periodontal ligament cells to root surfaces.29 TGF-Ƶ1
is essential for normal tissue remodeling and
wound healing; it is chemotactic for human ﬁbroblasts,30 enhances the proliferation and differentiation of osteoblasts,31–33 and intervenes in
angiogenesis and immunomodulation.34 BFGF
induces stimulation of periodontal ligament cell
proliferation, osteoblastic cell proliferation and
growth and ﬁbroblasts, and plays a role in angiogenesis.35–37 IGF-1, also known as somatomedin,
is a mediator in the activity of growth hormone38
and a positive regulator of cell proliferation and
differentiation for most cell types.39 EGF enhances the proliferation of keratinocytes40 and is
implicated in epithelialization, wound contraction and remodeling.41
Thus far, the majority of studies reporting
detection of one or some of the previously mentioned growth factors in PRP samples have been
conducted on nonclotted samples, without any
platelet activator added.3, 42–45 In our opinion,
direct analysis of the presence of growth factors
in PRP gel would provide a more accurate idea
regarding which are the bioactive constituents
of PRP gel.
El-Sharkawy et al. performed a similar study
based on a different technique, enzyme-linked
immunosorbent assay (ELISA), and the same
growth factor content of PRP was found.9 They
46 Volume 2 | Issue 2/2016

quantified platelet and growth factor levels.
PDGF, TGF-ʹ1, IGF-1, EGF, VEGF and bFGF were
also identiﬁed in their PRP samples. They attributed the biological properties of these growth
factors, such as proliferation of ﬁbroblasts and
periodontal ligament cells and extracellular matrix formation, to PRP. Lu et al. also used the same
technique, ELISA, and they identiﬁed and quantiﬁed PRP growth factors released (PDGF, TGF-ʹ1
and IGF-1), obtaining similar results, although no
search for EGF, VEGF or bFGF was conducted.2
Despite the contribution of our ﬁndings to the
understanding of PRP biology, they also raise
more questions that need to be addressed. The
identiﬁcation of these growth factors in PRP gel
only suggests their presence in the clot, without
providing evidence supporting its biological beneﬁt after its clinical usage, especially for regenerative approaches. Growth factors are proteins
that, once released from the producer cell, exert
a very localized action at speciﬁc ratios,46 owing
to their short life span. They are labile molecules
highly susceptible to denaturalization mediated
by proteases present in the wound site and to
phagocytosis and might even become solubilized
in the carrier.47 These undesirable events usually
lead to the inactivation or annulment of the biological properties of these mediators. For
instance, PDGF cannot be detected in circulating
blood in normal conditions, and when it is intravenously injected, its life span is around 2 min.48
This lack of long-term activity associated with
the short half-life of this platelet growth factor
may require repeated applications over time to
maintain their therapeutic effect.
Both the vehicle and concentration (dose) of
biological mediators, such as platelet growth
factors, may be critical factors to consider when
seeking to achieve controlled modulation of cellular events in the desired time interval.49 However, it has to be taken into consideration that
there is no currently available information about
the optimal dosages of PRP needed to achieve
the highest effectiveness.1
It is also important to note that the technique
used in this study for the detection of growth
factors, Western blotting, allows detection of the
presence of a determined protein in a sample by
highly speciﬁc binding of antibodies to epitopes
of that polypeptide. However, it is not possible
to ultimately determine whether the target protein is biologically active and therefore able to
exert its effect when applied to a wound. This
fact, along with the arguments discussed before,

Journal of
Oral Science & Rehabilitation

[47] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

moves us to reason that the beneﬁcial effects
obtained after application of autologous PRP gel
may not be mediated only by the action of growth
factors.
Considering this data, it is logical to outline
several questions and doubts regarding the variable amount of growth factors, presenting a true
ability to interact with the environment, that may
be released from the PRP gel sample that is clinically applied. Are those growth factors the
exclusive or major mediators responsible for a
change in the biological conditions that lead to
an improvement in tissue regeneration? Does the
ﬁbrillar component of the clot have a role in modulating the biological response that permits a
better clinical response? Or, is it a synergistic
effect between the ﬁbrillar scaffold and different
molecular components of blood plasma, among
which growth factors are present, that induces
those beneﬁcial effects?
Understanding the role of each component
of PRP gel in wound-healing events and the op-

timal concentration of molecules with the capacity of modulating these processes remains one
of the major challenges for researchers in this
ﬁeld of tissue engineering. In order to address
those questions, further in vitro and in vivo studies seeking to determine the physical interaction
of PRP elements with cell types present in the
craniofacial surgical ﬁeld and its impact on cell
proliferation and differentiation are needed.

Competing interests
The authors do not have any ﬁnancial interests,
either directly or indirectly, in the products listed
in the study.

Acknowledgments
This article was supported partially by Research
Group #CTS-583 (Junta de Andalucía, Spain).

References
1.
De Pascale MR, Sommese L, Casamassimi
A, Napoli C. Platelet derivatives in
regenerative medicine: an update.
→ Transfus Med Rev.
2015 Jan;29(1):52–61.

6.
Marx RE. Platelet-rich plasma: evidence to
support its use.
→ J Oral Maxillofac Surg.
2004 Apr;62(4):489–96.

2.
Lu HH, Vo JM, Chin HS, Lin J, Cozin M,
Tsay R, Eisig S, Landesberg R. Controlled
delivery of platelet-rich plasma-derived
growth factors for bone formation.
→ J Biomed Mater Res A.
2008 Sep;86(4):1128–36.

7.
Dohan DM, Choukroun J, Diss A, Dohan SL,
Dohan AJ, Mouhyi J, Gogly B. Platelet-rich
ﬁbrin (PRF): a second-generation platelet
concentrate. Part II: platelet-related
biologic features.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
2006 Mar;101(3):e45–50.

3.
Marx RE, Carlson ER, Eichstaedt RM,
Schimmele SR, Strauss JE, Georgeff KR.
Platelet-rich plasma: growth factor
enhancement for bone grafts.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
1998 Jun;85(6):638–46.

8.
Xie X, Zhang C, Tuan RS. Biology of
platelet-rich plasma and its clinical
application in cartilage repair.
→ Arthritis Res Ther.
2014 Feb;16(1):204.

4.
Anitua E. Plasma rich in growth factors:
preliminary results of use in the
preparation of future sites for implants.
→ Int J Oral Maxillofac Implants.
1999 Jul-Aug;14(4):529–35.
5.
Anitua E, Andia I, Ardanza B, Nurden P,
Nurden AT. Autologous platelets as a
source of proteins for healing and tissue
regeneration.
→ Thromb Haemost.
2004 Jan;91(1):4–15.

9.
El-Sharkawy H, Kantarci A, Deady J,
Hasturk H, Liu H, Alshahat M, Van Dyke TE.
Platelet-rich plasma: growth factors and
pro- and anti-inﬂammatory properties.
→ J Periodontol.
2007 Apr;78(4):661–9.

10.
Kim ES, Park EJ, Choung PH. Platelet
concentration and its effect on bone
formation in calvarial defects: an
experimental study in rabbits.
→ J Prosthet Dent.
2001 Oct;86(4):428–33.
11.
Kim SG, Kim WK, Park JC, Kim HJ. A
comparative study of osseointegration of
Avana implants in a demineralized
freeze-dried bone alone or with
platelet-rich plasma.
→ J Oral Maxillofac Surg.
2002 Sep;60(9):1018–25.
12.
Shanaman R, Filstein MR, Danesh-Meyer
MJ. Localized ridge augmentation using
GBR and platelet-rich plasma: case
reports.
→ Int J Periodontics Restorative Dent.
2001 Aug;21(4):345–55.
13.
Petrungaro PS. Treatment of the infected
implant site using platelet-rich plasma.
→ Compend Contin Educ Dent.
2002 Apr;23(4):363–6, 368, 370 passim;
quiz 378.
14.
Froum SJ, Wallace SS, Tarnow DP, Cho SC.
Effect of platelet-rich plasma on bone
growth and osseointegration in human
maxillary sinus grafts: three bilateral case
reports.
→ Int J Periodontics Restorative Dent.
2002 Feb;22(1):45–53.

Journal of
Oral Science & Rehabilitation

15.
Thor A. Reconstruction of the anterior
maxilla with platelet gel, autogenous bone,
and titanium mesh: a case report.
→ Clin Implant Dent Relat Res.
2002 Oct;4(3):150–5.
16.
Powell CA, Bannister SR, Mackey SA,
Maller SC, McDonnell HT, Deas DE.
Periodontal wound healing with and
without platelet-rich plasma: histologic
observations and assessment of ﬂap
tensile strength.
→ J Periodontol.
2009 Jun;80(6):985–92.
17.
Farina R, Bressan E, Taut A, Cucchi A,
Trombelli L. Plasma rich in growth factors
in human extraction sockets: a
radiographic and histomorphometric study
on early bone deposition.
→ Clin Oral Implants Res.
2013 Dec;24(12):1360–8.
18.
Bezgin T, Yilmaz AD, Celik BN, Kolsuz ME,
Sonmez H. Efficacy of platelet-rich plasma
as a scaffold in regenerative endodontic
treatment.
→ J Endod.
2015 Jan;41(1):36–44.

Volume 2 | Issue 2/2016 47

[48] => JOSR_2_A4.qxp_Layout 1

Composition of PRP

19.
Plachokova AS, Nikolidakis D, Mulder J,
Jansen JA, Creugers NH. Effect of
platelet-rich plasma on bone regeneration
in dentistry: a systematic review.
→ Clin Oral Implants Res.
2008 Jun;19(6):539–45.

26.
Rendu F, Brohard-Bohn B. The platelet
release reaction: granules’ constituents,
secretion and functions.
→ Platelets.
2001 Aug;12(5):261–73.
27.
Lindeboom JA, Mathura KR, Aartman IH,
Kroon FH, Milstein DM, Ince C. Inﬂuence of
the application of platelet-enriched plasma
in oral mucosal wound healing.
→ Clin Oral Implants Res.
2007 Feb;18(1):133–9.

20.
Forni F, Marzagalli M, Tesei P, Grassi A.
Platelet gel: applications in dental
regenerative surgery.
→ Blood Transfus.
2013 Jan;11(1):102–7.
21.
Pietrzak WS, Eppley BL. Platelet rich
plasma: biology and new technology.
→ J Craniofac Surg.
2005 Nov;16(6):1043–54.

28.
Zhang L, Leeman E, Carnes DC, Graves DT.
Human osteoblasts synthesize and
respond to platelet-derived growth factor.
→ Am J Physiol.
1991 Aug;261(2):C348–54.

22.
Man D, Plosker H, Winland-Brown JE. The
use of autologous platelet-rich plasma
(platelet gel) and autologous platelet-poor
plasma (ﬁbrin glue) in cosmetic surgery.
→ Plast Reconstr Surg.
2001 Jan;107(1):229–37; discussion
238–9.

29.
Gamal AY, Mailhot JM. The effect of local
delivery of PDGF-BB on attachment of
human periodontal ligament ﬁbroblasts to
periodontitis-affected root surfaces—in
vitro.
→ J Clin Periodontol.
2000 May;27(5):347–53.

23.
Thor A, Wannfors K, Sennerby L,
Rasmusson L. Reconstruction of the
severely resorbed maxilla with autogenous
bone, platelet-rich plasma, and implants:
1-year results of a controlled prospective
5-year study.
→ Clin Implant Dent Relat Res.
2005 Oct;7(4):209–20.
24.
Raghoebar GM, Schortinghuis J, Liem RS,
Ruben JL, Van Der Wal JE, Vissink A. Does
platelet-rich plasma promote remodeling
of autologous bone grafts used for
augmentation of the maxillary sinus ﬂoor?
→ Clin Oral Implants Res.
2005 Jun;16(3):349–56.
25.
Fernández-Barbero JE, Galindo-Moreno P,
Avila-Ortiz G, Caba O, Sánchez-Fernández
E, Wang HL. Flow cytometric and
morphological characterization of
platelet-rich plasma gel.
→ Clin Oral Implants Res.
2006 Dec;17(6):687–93.

30.
Postlethwaite AE, Keski-Oja J, Moses HL,
Kang AH. Stimulation of the chemotactic
migration of human ﬁbroblasts by
transforming growth factor ʹ.
→ J Exp Med.
1987 Jan;165(1):251–6.

34.
Ghosh D, Lili L, McGrail DJ, Matyunina LV,
McDonald JF, Dawson MR. Integral role of
platelet-derived growth factor in mediating
transforming growth factor-ʹ1-dependent
mesenchymal stem cell stiffening.
→ Stem Cells Dev.
2014 Feb;23(3):245–61.

41.
Brown GL, Curtsinger LJ, White M,
Mitchell RO, Pietsch J, Nordquist R, von
Fraunhofer A, Schultz GS. Acceleration of
tensile strength of incisions treated with
EGF and TGF-ʹ.
→ Ann Surg.
1988 Dec;208(6):788–94.

35.
Sonmez AB, Castelnuovo J. Applications of
basic ﬁbroblastic growth factor (FGF-2,
bFGF) in dentistry.
→ Dent Traumatol.
2014 Apr;30(2):107–11.

42.
Zimmermann R, Jakubietz R, Jakubietz M,
Strasser E, Schlegel A, Wiltfang J, Eckstein
R. Different preparation methods to obtain
platelet components as a source of growth
factors for local application.
→ Transfusion.
2001 Oct;41(10):1217–24.

36.
Terranova VP, Odziemiec C, Tweden KS,
Spadone DP. Repopulation of dentin
surfaces by periodontal ligament cells and
endothelial cells: effect of basic ﬁbroblast
growth factor.
→ J Periodontol.
1989 Jun;60(6):293–301.
37.
Cross MJ, Claesson-Welsh L. FGF and
VEGF function in angiogenesis: signalling
pathways, biological responses and
therapeutic inhibition.
→ Trends Pharmacol Sci.
2001 Apr;22(4):201–7.
38.
Laron Z. Clinical use of somatomedin-1: yes
or no?
→ Paediatr Drugs.
1999 Jul-Sep;1(3):155–9.

31.
Centrella M, McCarthy TL, Canalis E.
Transforming growth factor Ƶ is a
bifunctional regulator of replication and
collagen synthesis in osteoblast-enriched
cell cultures from fetal rat bone.
→ J Biol Chem.
1987 Feb;262(6):2869–74.

39.
Ren J, Anversa P. The insulin-like growth
factor I system: physiological and
pathophysiological implication in
cardiovascular diseases associated with
metabolic syndrome.
→ Biochem Pharmacol.
2015 Feb;93(4):409–17.

32.
Mundy GR, Boyce B, Hughes D, Wright K,
Bonewald L, Dallas S, Harris S,
Ghosh-Choudhury N, Chen D, Dunstan C,
Izbicka E, Yoneda T. The effects of
cytokines and growth factors on
osteoblastic cells.
→ Bone.
1995 Aug;17(2 Suppl):S71–75.

40.
Brown GL, Nanney LB, Griffen J, Cramer
AB, Yancey JM, Curtsinger LJ 3rd, Holtzin
L, Schultz GS, Jurkiewicz MJ, Lynch JB.
Enhancement of wound healing by topical
treatment with epidermal growth factor.
→ N Engl J Med.
1989 Jul;321(2):76–9.

33.
Graham S, Leonidou A, Lester M, Heliotis
M, Mantalaris A, Tsiridis E. Investigating
the role of PDGF as a potential drug
therapy in bone formation and fracture
healing.
→ Expert Opin Investig Drugs.
2009 Nov;18(11):1633–54.

48 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

43.
Weibric G, Buch RS, Kleis WK, Hafner G,
Hitzler WE, Wagner W. Quantiﬁcation of
thrombocyte growth factors in platelet
concentrates produced by discontinuous
cell separation.
→ Growth Factors.
2002 Jun;20(2):93–7.
44.
Weibrich G, Kleis WK, Buch R, Hitzler WE,
Hafner G. The Harvest Smart PReP™
system versus the Friadent-Schütze
platelet-rich plasma kit.
→ Clin Oral Implants Res.
2003 Apr;14(2):233–9.
45.
Eppley BL, Woodell JE, Higgins J. Platelet
quantiﬁcation and growth factor analysis
from platelet-rich plasma: implications for
wound healing.
→ Plast Reconstr Surg.
2004 Nov;114(6):1502–8.
46.
Vilček J. The cytokines: an overview. In:
Thomson AW, Lotze MT, editors.
→ The cytokine handbook. Vol. 1. Avon
(MA): Academic Press;
2003. p. 3–18.
47.
Giannobile WV. Periodontal tissue engineering by growth factors.
→ Bone.
1996 Jul;19(1 Suppl):S23–37.
48.
Nimni ME. Polypeptide growth factors:
targeted delivery systems.
→ Biomaterials.
1997 Sep;18(18):1201–25.
49.
Hokugo A, Ozeki M, Kawakami O,
Sugimoto K, Mushimoto K, Morita S,
Tabata Y. Augmented bone regeneration
activity of platelet-rich plasma by
biodegradable gelatin hydrogel.
→ Tissue Eng.
2005 Jul-Aug;11(7-8):1224–33.

[49] => JOSR_2_A4.qxp_Layout 1

Make plans to attend and present your research at the 94th General Session &
Exhibition of the International Association for Dental Research, held in conjunction
with the 3rd Meeting of the IADR Asia Paciﬁc Region and the 35th Annual Meeting of
the IADR Korean Division. This will be an exciting opportunity to network with
other delegates while exploring cutting-edge scientiﬁc discoveries!
Following are the conﬁrmed Distinguished Lecture Series Speakers:
Eunjoon Kim
Center for Synaptic Brain Dysfunctions, Institute for Basic Science and
The Department of Biological Sciences, Korea Advanced Institute of Science and
Technology (KAIST)
Daejeon, Republic of Korea
Pekka Puska
Former Director General, National Institute for Health and Welfare
Helsinki, Finland
Important Dates:
Oct. 26, 2015: Deadline to submit proposals.
Jan. 19, 2016:
Deadline to submit abstracts.
Apr. 20, 2016: Presenter pre-registration deadline.
May 18, 2016: Non-presenter pre-registration deadline.
Continue to visit the IADR website for more information as it becomes available.
We look forward to seeing you in Seoul!

[50] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Spontaneous bone
regeneration after removal
of cysts: One-year follow-up
of 336 consecutive cases

Abstract
Objective
Marco Di Dio,a Dario Scarapecchia,b Daniela Porcellic
& Claudio Arcurid

The objective of this study was to assess spontaneous bone healing after
enucleation of large jaw cysts without using any grafting material.

Department of Oral Surgery, San Giovanni Calibita
Fatebenefratelli Hospital, Rome, Italy
b
Private practice, Rome, Italy
c
Department of Odontostomatology, San Giovanni Calibita
Fatebenefratelli Hospital, Rome, Italy;
University of Rome Tor Vergata, Rome, Italy
d
Department of Odontostomatology, San Giovanni Calibita
Fatebenefratelli Hospital, Rome, Italy;
University of Rome Tor Vergata, Rome, Italy
Corresponding author:
Dr. Daniela Porcelli
Department of Oral Surgery
San Giovanni Calibita Fatebenefratelli Hospital
Rome
Italy
T +39 348 162 2588
porcellidaniela@libero.it
How to cite this article:

Materials and methods

The study was conducted at the Department of Oral Surgery of the San
Giovanni Calibita Fatebenefratelli Hospital, Rome, Italy. Between January
2000 and July 2012, 336 consecutive patients with large jaw cysts
(average size of 1.50 ± 0.80 × 1.06 ± 0.50 cm) were treated by a Partch II
surgical enucleation. Postoperative clinical and radiographic examinations
were performed at ten and 30 days, respectively, and then at six and
12 months on the basis of panoramic radiographs, using the Kawai et al.
classiﬁcation.
Results

Healing and radiographic spontaneous bone regeneration of the residual
cavities were obtained in all of the cases. Radiographic controls after cystic
enucleation showed no evidence of recurrence.

Di Dio M, Scarapecchia D, Porcelli D, Arcuri C.
Spontaneous bone regeneration after removal of cysts:
one-year follow-up of 336 consecutive cases.

Conclusion

The study demonstrated that spontaneous bone regeneration can be
obtained after enucleation of large jaw cysts without using ﬁlling material, thereby decreasing the ﬁnancial and biological costs and reducing the
risk of postoperative complications.

J Oral Science Rehabilitation.
2016 Jun;2(2):50–6.

Keywords

Odontogenic cysts, enucleation, oral surgery, spontaneous bone regeneration.
50 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[51] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Introduction

Surgical protocol

The gold standard for the treatment of most jaw
cysts is enucleation of the lesions. The cavity remaining after enucleation may heal spontaneously by the physiological appositional mechanism
of bone growth. However, in larger bony defects,
the use of bone grafting materials is still controversial.1–13 Many studies have concluded that
bone grafts should be used to reduce the risk of
jaw weakness.14–18 Some researchers have supported that the remaining cystic cavities should
be ﬁlled with biointegrative materials to prepare
the site for implant placement.19 However, other
authors have reported that spontaneous bone
healing occurred without the use of bone grafts.20
According to this last study, bone density can
increase by 48% after 12 months and by 91%
after 24 months, as seen after marsupialization
of large jaw cysts. The success of spontaneous
regeneration should be directly related to the size
of the bony defect, anatomical features, patient’s
age and other parameters, such as monocortical
or bicortical defect type.19
The objective of this retrospective clinical
study was to evaluate spontaneous bone regeneration after enucleation of large jaw cysts,
achieved with a conservative surgical technique,
without using any ﬁlling material.

The surgery was conducted by one surgeon
(MDD) in a single session for each patient, with
standardized techniques. All of the patients received antibiotics before surgery. Local antimicrobial treatment was performed with 0.12%
chlorhexidine digluconate mouth rinses t.i.d. for
two weeks, starting three days before surgery,
interrupted only on the ﬁrst postoperative day.
The majority of the surgeries (93.5%) were performed under local anesthesia with 2% mepivacaine. Only 22 (6.5%) surgical procedures were
conducted under general anesthesia (in cases of
cysts entering into the nasal cavity), depending
on the general conditions, compliance, local and
anatomical characteristics (such as the lesion
extent), the site accessibility and the expected
duration of the surgery. When the cysts were
placed into the anterior region of the mandible,
bilateral local anesthesia at Spix’s spine with 2%
mepivacaine and inﬁltrative anesthesia with 2%
mepivacaine and 1:100,000 epinephrine was
administered. After the elevation of a fullthickness ﬂap of adequate dimensions, with two
lateral releasing incisions on the vestibular aspect
(to preserve the lingual nerve in the mandible;
Figs. 3 & 4), conservative access to the lesion was
obtained using a round bur in a low-speed handpiece under irrigation with sterile saline (Fig. 5).
In all of the cases, there was very little bone debris, owing to the minimally invasive surgical
approach. Particular care was taken to preserve
the maximum amount of bone in order to allow
postoperative regeneration of the defect and to
provide adequate support to the soft tissue
during the healing period (bone bridging). Whenever possible, the cysts were enucleated in one
piece with minimal invasion. The remaining cyst
cavity was curetted to remove all residual fragments and to reduce the risk of recurrence
(Fig. 6). The hopeless teeth were either extracted or endodontically treated, followed by apicectomy. In all of the cases, after the careful cleaning
of the residual cavity, a primary closure was performed with a nonresorbable thread and interrupted sutures. No grafting material was placed
into the residual bone sites. In all of the cases, a
histological examination was performed, after
ﬁxation in a 4% formalin solution (Fig. 7).
The patients were advised to refrain from
drinking and eating for 2 h after the surgical procedure and to then eat only cold and soft food for
24 h. After ten days, upon removal of the sutures,
the wound was examined and controlled.

Materials and methods
This study was conducted at the Department of
Oral Surgery of the San Giovanni Calibita, Fatebenefratelli Hospital, Rome, Italy, from January
2000 to July 2012. All consecutive patients requiring a Partch II surgical intervention for cyst
removal were enrolled. Each patient was completely informed about the possible risks of the
intervention and the surgical procedure.
Preoperative analysis

Panoramic radiographs were obtained for all of
the patients subjected to surgical enucleation
(Fig. 1). The dimensions of the cysts were evaluated on panoramic radiographs taken just before
surgical treatment. A preoperative computed
tomography (CT) scan was required only in cases
of very large jaw cysts with erosion of cortical
plates, in order to evaluate more precisely the
extent of the lesions (Fig. 2).

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 51

[52] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Figs. 1 & 2

Figs. 3 & 4

Fig. 1
Preoperative radiographic
view (2005).
Fig. 2
Preoperative CT scan view
(2005).
Fig. 3
Preoperative clinical view.
Fig. 4
The surgery was performed
under local anesthesia to
obtain a larger working area.

All of the patients were followed for possible complications, including hemorrhagic complications,
swelling, hematoma and ecchymosis. Follow-ups
entailed both clinical and radiographic evaluations
in order to assess the reduction in size of the residual cavities. Clinical controls were performed
ten days after surgery and radiographic assessment after 30 days and at six and 12 months
postoperatively. The radiographic examinations,
performed in order to evaluate the bone regeneration rate, entailed preoperative and postoperative panoramic radiographs and, in some cases,
CT scans (Figs. 8 & 9). A CT dental scan was required in order to evaluate more precisely the rate
of bone healing in the buccolingual dimension,
using axial slices, if necessary. The ﬁndings from
the panoramic radiographs were analyzed both
subjectively and using the Kawai et al. radiographic classiﬁcation, which evaluates the variation of the surgical site margins and the interior
contents of the sites based on radiographs.21

52 Volume 2 | Issue 2/2016

Results
The sample included 336 patients, 200 males
(59.5%) and 136 females (40.5%) ranging from
10 to 83 years of age (mean age and standard
deviation of 43.4 ± 16.8), as demonstrated in
Table 1. No patients were lost during follow-up.
The majority (68.8%) of the patients had mandibular cysts and the remainder of the sample
(31.3%) had maxillary lesions.
Surgical and radiographic data

The mean dimensions of the bony defects were
1.50 ± 0.80 × 1.06 ± 0.50 cm. Primary closure
was obtained in all of the cases. Minor complications (swelling, hematoma and ecchymosis
were present in 85% of the cases) were reported
during the ﬁrst week. At the second recall, these
minor complications were no longer present. No
hemorrhagic complications occurred. An inferior
alveolar nerve paresthesia and a compound fracture both occurred in only one patient (0.3%).

Journal of
Oral Science & Rehabilitation

[53] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Figs. 5 & 6

Fig. 5
An intra-oral view.
Fig. 6
An intra-oral view during
the cyst enucleation.
Fig. 7
The cystic specimen.
Fig. 8

Fig. 7

Postoperative radiographic
view (six months after
surgery).
Fig. 9
Postoperative radiographic
view (one year after surgery).

Figs. 8 & 9

The patient with the mandibular fracture was
treated with analgesics and a soft diet under
close observation. No surgical intervention to
reduce and stabilize the fracture was carried out.
At six months postoperatively, the affected patient experienced a spontaneous full recovery of
the inferior alveolar nerve paresthesia.
Clinical and radiographic evaluation performed 12 months after the surgical procedure
showed complete healing of the lesions in all of
the cases, with no sign of inﬂammation, infection or recurrence. On the basis of Kawai et al.’s
criteria21 and of the postoperative radiographic

and clinical controls, all of these areas were considered healthy and showed complete bone recovery. The postoperative CT scans performed
on patients with very large mandibular cysts
showed complete bone regeneration and reconstitution of almost normal anatomy of the previously affected jaw segment 12 months after
surgery. There were also gradual increases in
bone density in both mandibular and maxillary
defects. In all of the cases, the clinical healing
patterns were similar.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 53

[54] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Histological data

The differential diagnosis between odontogenic
cysts and ameloblastomas could be attained by
analyzing the postoperative recurrence in the
short term. Differences such as root resorption
of adjacent teeth may aid the clinician in the preoperative differential diagnosis. In a radiographic preoperative analysis, ameloblastomas proved
to have a root resorptive potential far greater than
did other cystic lesions. No recurrence was noted
during the entire follow-up period of the study,
although the incidence was about 3%. However,
ongoing follow-up examination is required and
essential for management.

According to the World Health Organization classiﬁcation, most of the cysts were odontogenic
cysts of inﬂammatory origin, followed by odontogenic cysts of unspeciﬁed nature; radicular
cysts (also termed periapical cysts); cystic lesions
of odontogenic developmental dentigerous (or
follicular) nature, unilocular and/or multilocular;
unspeciﬁed granulation tissue; odontomas; periapical granulomas; ameloblastomas; keratocysts;
nonodontogenic nasopalatine duct cysts; inﬂammatory residual cysts; and lesions due to other
diseases, such as odontogenic ﬁbromas, nonepConclusion
ithelial, traumatic and hemorrhagic cysts, sinus
polyposis, epulis, ﬁbrous bone dysplasia and oral
melanosis. The diagnoses are reported in Table 2. Within the limitations of this study, some observations in agreement with current literature can
Discussion
be made. Spontaneous bone regeneration with
bone bridging outside the residual cyst cavity can
Bone reconstruction has been considered an es- occur after surgical removal of large jaw cysts
sential requirement for complete functional reha- without the aid of any grafting materials, accordbilitation after jaw surgery. Although many stud- ing to evidence-based clinical and radiographic
ies have supported the use of different bone grafts criteria. There was also a reduction of the risks of
to reduce the risk of jaw weakness,14–17 the present paresthesia and fracture in the mandible, owing
study showed that spontaneous bone regenera- to the conservative approach. This will simplify
tion occurred in all of the residual bony defects the surgical procedure, decreasing ﬁnancial and
without the use of any ﬁlling material. The phys- biological costs and reducing the risk of postiological healing process occurred with sponta- operative complications.
neous bone regeneration even in the presence of
large residual cystic cavities. The present study
Competing interests
suggested that this type of intervention was very
safe and minimally invasive, despite the increased The authors declare that they have no competing
surgical duration and technical complexity, with interests.
a complete recovery of the area occupied by jaw
cysts. The bone recovery could be demonstrated
with absolute accuracy only on CT scan controls,
comparing on a digitalized image the preoperative
and postoperative bone density. However, the
main limitation of the present study was the short
follow-up period. In fact, in order to conﬁrm data
from the present study, a longitudinal control (ﬁve
years after surgery) would be recommended.
However, in most cases, patients with cysts
in edentulous areas underwent a CT scan evaluation for the following implant-supported prosthetic rehabilitation.22 Morphometric analysis,
similarly to Chiapasco et al.,14 was not performed
because implant stability and survival clinically
demonstrated that bone was of a good quality.
These results corroborate those of Pradel et al.,
who concluded that the bone density increased
after enucleation of large mandibular cysts without using ﬁlling material.20 Similar results were
obtained by Chiapasco et al.14
54 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[55] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

Table 1

Variables

Number of patients

Table 1

%

Demographic composition
of the study population and
clinical features.

Sex
Males

200

59.5

Females

136

40.5
Table 2

Age category (years)
Mean

336

Distribution of oral cysts
in the population sample.

100

43.4 ± 16.8

*

min. 10

**

max. 83
Location of cyst
Mandibular

231

68.8

Maxillary

105

31.2

Local

314

93.5

General

22

6.5

Paresthesia

1

0.3

Fracture

1

0.3

336

100

Unspeciﬁed.
Such as odontogenic
ﬁbromas, nonepithelial,
traumatic and hemorrhagic
cysts, sinus polyposis,
epulis, ﬁbrous bone
dysplasia and oral
melanosis.

Anesthesia

Complications

Dimension of bony defects (cm)
Mean
1.50 ± 0.80 × 1.06 ± 0.50 cm

2

13

-

-

-

4

-

-

1

-

1

30

2002

10

9

3

-

-

-

2

-

1

-

-

1

26

2003

13

2

9

-

1

2

4

-

-

1

-

-

32

2004

10

2

3

-

1

1

4

-

-

-

-

1

22

2005

19

3

8

-

1

1

-

-

-

-

-

2

34

2006

8

4

3

-

-

1

-

-

-

-

-

-

16

2007

8

5

2

-

-

3

6

-

1

-

1

-

26

2008

16

2

7

-

-

1

7

-

1

-

1

2

37

2009

8

2

5

1

-

1

9

-

1

-

-

-

27

2010

10

2

3

-

1

-

13

1

1

-

1

2

34

2011

5

2

3

-

-

2

15

2

-

-

-

1

30

2012

4

-

2

-

-

2

13

-

-

1

-

-

22

Total

120

35

61

1

4

14

77

3

5

3

3

10

336

%

35.7

10.4

18.1

0.3

1.2

4.2

22.9

0.9

1.5

0.9

0.9

3

100

Volume 2 | Issue 2/2016 55

Total

Other**

Keratocysts

Odontomas

Ameloblastomas

Odontogenic cysts,
unspeciﬁed nature

Periapical
granulomas

Residual cysts

Journal of
Oral Science & Rehabilitation

Nasopalatine cysts

9

Granulation tissue*

Odontogenic cysts, developmental dentigerous nature

2001

Year

Radicular cysts

Odontogenic cysts,
inﬂammatory origin

Table 2

[56] => JOSR_2_A4.qxp_Layout 1

Spontaneous bone regeneration: Analysis of 336 cases

References
1.
Getter L, Bhaskar SN, Cutright DE, Perez B,
Brady JM, Driskell TD, O’Hara MJ. Three
biodegradable calcium phosphate slurry
implants in bone.
→ J Oral Surg.
1972 Apr;30(4):263–8.
2.
Salama R. Xenogeneic bone grafting
in humans.
→ Clin Orthop Relat Res.
1983 Apr;(174):113–21.
3.
Horowitz I, Bodner L. Use of xenograft
bone with aspirated bone marrow for
treatment of cystic defect of the jaws.
→ Head Neck.
1989 Nov-Dec;11(6):516–23.
4.
Mitchell R. An evaluation of bone healing
in cavities in the jaws implanted with
a collagen matrix.
→ Br J Oral Maxillofac Surg.
1992 Jun;30(3):180–2.
5.
Moskow BS, Gold SI, Gottsegen R. Effects
of scleral collagen upon the healing
of experimental osseous wounds.
→ J Periodontol.
1976 Oct;47(10):596–606.
6.
Del Balso AM, Adrian JC. Collagen gel
in osseous defects: a preliminary report.
→ Oral Surg Oral Med Oral Pathol.
1976 Nov;42(5):562–9.

7.
Bodner L. Effect of decalciﬁed freeze-dried
bone allograft on the healing of jaw
defects after cyst enucleation.
→ J Oral Maxillofac Surg.
1996 Nov;54(11):1282–6.

13.
Marble HB Jr. Homografts of freeze-dried
bone in cystic defects of the jaws: a survey
of ninety-one cases.
→ Oral Surg Oral Med Oral Pathol.
1968 Jul;26(1):118–23.

8.
Bodner L. Osseous regeneration in the
jaws using demineralized allogenic bone
implants.
→ J Craniomaxillofac Surg.
1998 Apr;26(2):116–20.

14.
Chiapasco M, Rossi A, Motta JJ,
Crescentini M. Spontaneous bone
regeneration after enucleation of large
mandibular cysts: a radiographic
computed analysis of 27 consecutive
cases.
→ J Oral Maxillofac Surg.
2000 Sep;58(9):942–8.

9.
Schepers EJ, Ducheyne P, Barbier L,
Schepers S. Bioactive glass particles of
narrow size range: a new material for the
repair of bone defects.
→ Implant Dent.
1993 Fall;2(3):151–6.
10.
Marx RE, Kline SN, Johnson RP, Malinin TI,
Matthews JG 2nd, Gambill V. The use of
freeze-dried allogeneic bone in oral and
maxillofacial surgery.
→ J Oral Surg.
1981 Apr;39(4):264–74.
11.
Spengos MN. Irradiated allogeneic bone
grafts in the treatment of odontogenic
cysts.
→ J Oral Surg.
1974 Sep;32(9):674–8.
12.
Constantinides J, Zachariades N.
Homogenous bone grafts to the mandible.
→ J Oral Surg.
1978 Aug;36(8):599–603.

56 Volume 2 | Issue 2/2016

15.
Damante JH, Da S Guerra EN, Ferreira O
Jr. Spontaneous resolution of simple bone
cysts.
→ Dentomaxillofac Radiol.
2002 May;31(3):182–6.
16.
Caicoya SO. Bone cavity ﬁlling with
alloplastic material in maxillofacial
surgery.
→ Rev Esp Cir Oral y Maxillofac.
2007 Jan-Feb;29(1):21–32.
17.
Wiltfang J, Kloss FR, Kessler P, Nkenke E,
Schultze-Mosgau S, Zimmermann R,
Schlegel KA. Effects of platelet-rich
plasma on bone healing in combination
with autogenous bone and bone
substitutes in critical-size defects: an
animal experiment.
→ Clin Oral Implants Res.
2004 Apr;15(2):187–93.

Journal of
Oral Science & Rehabilitation

18.
Santamaría J, García AM, de Vicente JC,
Landa S, López-Arranz JS. Bone
regeneration after radicular cyst removal
with and without guided bone regeneration: pathology.
→ Int J Oral Maxillofac Surg.
1998 Apr;27(2):118–20.
19.
Ihan Hren N, Miljavec M. Spontaneous
bone healing of the large bone defects
in the mandible.
→ Int J Oral Maxillofac Surg.
2008 Dec;37(12):1111–6.
20.
Pradel W, Eckelt U, Lauer G. Bone
regeneration after enucleation of
mandibular cysts: comparing autogenous
grafts from tissue-engineered bone and
iliac bone.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
2006 Mar;101(3):285–90.
21.
Kawai T, Murakami S, Hiranuma H, Sakuda
M. Healing after removal of benign cysts
and tumors of the jaws: a radiologic
appraisal.
→ Oral Surg Oral Med Oral Pathol Oral
Radiol Endod.
1995 Apr;79(4):517–25.
22.
Di Dio M, De Luca M, Cammarata L,
Pierazzi G. Bone regeneration after
removal of a mandibular cyst and
following prosthetic rehabilitation
with implants. Case report.
→ Minerva Stomatol.
2005 Jun;54(6):373–8.

[57] => JOSR_2_A4.qxp_Layout 1

PRINT
L
DIGITA N
IO
T
A
C
U
ED
EVENTS

NG
I
R
U
D
IT US

VIS

6
1
0
2
FDI 8

ON
PAVILI
6
3
C
7
2
C
BOOTH

The DTI publishing group is composed of the world’s leading
dental trade publishers that reach more than 650,000 dentists
in more than 90 countries.

[58] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

Knowledge about risk
factors associated with
periodontal disease among
patients referred to a
specialist periodontal clinic
Abstract
Objective
Giovanni Serino,a, b Masahiro Wadaa,c
& Konstantinos Bougasa
a

Department of Periodontology, Södra Älvsborg Hospital,
Borås, Sweden
b
Research and Development Unit, Southern Älvsborg
County, Borås, Sweden
c
Department of Prosthodontics, Gerodontology
and Oral Rehabilitation, Graduate School of Dentistry,
Osaka University, Osaka, Japan
Corresponding author:
Dr. Giovanni Serino
Department of Periodontology
Södra Älvsborg Hospital
50182 Borås
Sweden

The patient’s awareness and knowledge of periodontal disease is a key
factor for successful periodontal treatment. The objective of this study
was to evaluate this knowledge among patients referred to a specialist
periodontal clinic.
Methods

145 consecutive patients referred for treatment of periodontitis were
asked about the causes/risk factors associated to periodontitis. Their answers were collated into the following groups: genetics/inheritance,
stress, smoking, poor oral hygiene/bacteria, systemic disease (diabetes,
cardiovascular disease, medicine intake).
Results

T +46 33 661 3750
F +46 33 616 1235
giovanni.serino@vgregion.se
How to cite this article:
Serino G, Wada M, Bougas K. Knowledge about risk factors
associated with periodontal disease among patients referred
to a specialist periodontal clinic.
J Oral Science Rehabilitation.
2016 Jun;2(2):58–63.

Among the 145 patients referred, 60% had some knowledge about the
causes of or risk factors associated to periodontal disease. Among these
87 patients, poor oral hygiene/bacteria was the most mentioned cause
(40.6%), followed by smoking (22.9%). Genetics/inheritance, stress and
systemic disease were seldom reported. The majority of the patients
(70.1%) with knowledge about periodontal disease had received information about the disease from the dental staff, while the rest had acquired
their knowledge from other sources.
Conclusion

The knowledge about the etiology of periodontal disease among the referred patients was poor since 40% had not received any information
about the disease. In order to treat and control periodontal disease effectively, programs with a focus on improving both professional and patient
awareness of periodontal disease are needed.
Keywords

Periodontal disease, risk factors, plaque control, compliance.
58 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[59] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

Introduction

Materials and methods

The role of plaque accumulation as an etiological
factor to the development of periodontal disease
is well established.1–3 In the last decades, some
risk factors associated with the progression of
periodontal disease have also been identified
(i.e., specific bacteria, smoking habit, poorly
controlled diabetes, stress, obesity, gender,
socio-economic status, genetics).4 The association between periodontal status and systemic
diseases, such as cardiovascular disease, respiratory disease and obesity, has also been highlighted during the last years.5–8 It is the duty of
dentists and dental hygienists to transfer this
knowledge to the patients. It has been reported
that once patients are informed about the nature
of their disease, the dental professionals are
consequently able to obtain the patients’ compliance in establishing good periodontal health
behavior.9 In this matter, Horne et al. identiﬁed
three important aspects: the patient’s compliance (“the extent to which the patient’s behavior
matches the prescriber’s recommendations”), the
adherence (the agreement between the patient
and the health care provider to follow the prescriber’s recommendations) and the concordance
(the agreement between a patient and a health
care professional in determining whether, when
and how medicines have to be taken).10
Blinkhorn considers that unsatisfactory adherence can often be explained by inadequate
information and when the information is irrelevant to the patient.11 The patient’s awareness
and knowledge of periodontal disease appears
also to be a key factor for successful periodontal
treatment.12, 13 Deinzer et al., in a study involving
1,001 interviews in a German community, reported a deﬁcit in knowledge about risk factors
associated with periodontal disease and suggested that education on periodontal disease
should be improved.9 Pralhad and Thomas reported that there were some differences in the
knowledge of periodontitis among different
health care professionals.14
Knowledge about risk factors associated
with periodontal disease among patients referred to specialist periodontal clinics has not
yet evaluated. For this reason, the objective of
the present study was to evaluate knowledge
about periodontal disease among patients referred to a specialist periodontal clinic for a periodontal examination. The second objective was
to evaluate the source of the patients’ information.

All consecutive patients (N = 145) referred to the
specialist periodontal clinic in Borås, Sweden, for
a periodontal clinical examination between June
and December 2014 were included. The patients
were referred from private and public dental clinics in the county of Södra Älvsborg, in Sweden.
After registration of the patients’ anamneses
and before undergoing clinical examination, the
patients were asked whether they had been referred from a private or public clinic, whether they
knew the reason why they had been referred to
a specialist clinic (yes/no) and whether they knew
about possible causes/risk factors associated
with periodontal disease. Patients could express
one or more causes and did not have to choose
from a list of suggestions or a questionnaire. Their
answers were then collated into the following
groups: genetics/inheritance, stress, smoking,
poor oral hygiene/bacteria, systemic disease (diabetes, cardiovascular disease, medicine intake).
The patients were also asked whether they had
obtained their knowledge on periodontal disease
from dental professionals, the Internet, newspapers or other sources.
The patients were informed that their answers
were being collected anonymously for research
analysis. All of the patients gave their consent.
Statistical analysis

Mean value and standard deviation were used for
data description. The percentage of patients with
respect to the different answers was calculated
and differences were analyzed by a chi-squared
test, using IBM SPSS Statistics (Version 22.0;
IBM, Armonk, N.Y., U.S.). A p-value of < 0.05 was
considered to be signiﬁcant.

Results
The number of patients included in the study was
145; 64 were males (mean age of 54.4; S.D. ± 14.6)
and 81 were females (mean age of 57.8;
S.D. ± 15.8). Of these patients, 37.2% had been
referred from private clinics and 62.8% from
public clinics (Table 1). Only 9.7% had not been
informed about the reason they were being referred to the specialist clinic, and in this respect,
no difference was noted between private and
public dental clinics (Table 2). When asked
whether they had any knowledge about the
causes of or risk factors for periodontal disease

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 59

[60] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

Table 1
Sample description.

Table 1

N = 145

%

Mean age (years)

S.D. (years)

Referral from

Table 2

Private clinics

54

37.2

61.8

13.9

Awareness of the reason
for referral to a specialist
periodontal clinic.

Public clinics

91

62.8

52.4

15.0

Male

64

44.1

54.4

14.6

Female

81

55.9

57.8

15.8

Total

145

100

56.0

15.3

Sex

Table 2

Difference according to sex
Male (%)

Female (%)

All (%)

Private clinics

91.6

83.3

Public clinics

89.7

Total

90.5

ǈ2

P-value

87.0

0.9059

0.365

94.2

92.3

0.7949

0.427

90.2

90.3

0.0469

0.963

(yes/no), only 60% answered “yes”. The mean age
of the patients who answered “yes” was 58 ± 17
and was 55 ± 14 for the patients who answered
“no”, and these values were not statistically signiﬁcantly different. Concerning the 40% of patients without any knowledge about the causes
of or risk factors for periodontal disease, no difference was noted between patients referred
from private dental clinics or those referred from
public dental clinics (Fig. 1). Among the 87 patients with knowledge about the causes of or risk
factors for periodontal disease, 53 (61%) expressed only one possible cause, 24 (28%) two
causes and 10 (11%) three (Fig. 2). Poor oral
hygiene/bacteria was the most commonly mentioned cause of periodontal disease (40.6%),
followed by smoking (22.9%). Among the patients who reported only one cause, poor oral
hygiene/bacteria was the most cited. In patients
who mentioned two causes, smoking was the
most cited, followed by poor oral hygiene/bacteria and genetics/inheritance. Stress and systemic disease were seldom reported (Fig. 2). The
majority of the patients (70.1%) with knowledge
about periodontal disease stated that they had
been informed about the causes of the disease
by dental professionals, while the rest of the
patients had obtained their knowledge from the
Internet, magazines or other sources (Fig. 3).
60 Volume 2 | Issue 2/2016

Discussion
The objective of the present study was to investigate the knowledge about periodontal disease
among patients referred to a specialist periodontal clinic. All of the patients regularly visited public or private dental clinics for dental treatment
and received periodontal nonsurgical therapy at
least once a year, among other dental treatments.
Among those patients, 90.3% knew the reason
for their referral to a specialist clinic. When the
patients were asked whether they were familiar
with the causes of periodontal disease, surprisingly, 40% answered “no”, even though they had
been sent to a specialist clinic and received regular nonsurgical periodontal treatment from their
dentist or dental hygienist. Regardless of whether
they were referred from public or private clinics,
the percentage of patients with no knowledge
about periodontal disease was similar. Males
tended to have less knowledge than females. It
has been suggested that men may have less
interest in their oral health and knowledge about
periodontal disease compared with women.15 The
high frequency of patients without any knowledge about periodontal disease among these
regular recipients of dental care highlights the
ineffectiveness in transferring individual tailored
information from the professional dental staff to

Journal of
Oral Science & Rehabilitation

[61] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

Fig. 1

Fig. 1
Knowledge about causes of
or risk factors for periodontal
disease. Only about 60% of
patients overall responded
positively, irrespective of
whether they were referred
from private or public dental
clinics.
Fig. 2
Answers from the 87 patients
with knowledge about
the causes of or risk factors
for periodontal disease:
The graph on the left shows
that 60.9% of these
patients expressed only
one putative cause, while
39.1% cited two or more.
The graph on the right shows
that poor oral hygiene/
bacteria was the most
mentioned cause of
periodontal disease (40.6%),
followed by smoking (22.9%).
Stress, genetics/inheritance
and systemic disease were
seldom reported (4.5%, 17.5%
and 14.5%, respectively).

Fig. 2

Fig. 3
The source of information
among the 87 patients
with knowledge about
periodontal disease:
The majority had obtained
the information from
dental professionals, but
30% of them had gained
their knowledge from other
sources.
Fig. 3

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 61

[62] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

the patients, which might be due to low interest
among general practitioners in the etiology and
prevention of periodontal disease16 or to inadequate techniques used to achieve patients’
awareness of the disease and compliance.17, 18
Compliance with periodontal therapy is directly
related to its success.13 Gao et al. reviewed the
effect of motivational interviewing in improving
periodontal health and concluded that dental
professionals should assess the presence of adequate knowledge of periodontal disease before
starting treatment.19
It is important to point out that the patients
in our study were asked whether they had any
knowledge about periodontal disease and that
they answered using their own words, not via a
questionnaire requiring selection from multiple
options. Their answers were then collated into
different groups of causes or risk factors. The
majority of the patients cited only one cause and
the remainder reported two or more causes.
Among the patients who gave only one cause of
periodontal disease, the majority cited poor oral
hygiene/bacteria; poor oral hygiene/bacteria was
also the most common cause reported when data
from all of the patients were considered. The
second most common cause was smoking. It is
well established that poor oral hygiene is a major
risk factor for periodontal disease, as are smoking,
stress, genetic factors, diabetes, obesity and cardiovascular disease.4 Surprisingly, among those
patients who cited two causes, smoking was more
commonly mentioned than was poor oral hygiene/
bacteria. It is reported in the literature that smoking is a risk factor for periodontal disease and
results in accelerated onset, severity and progression of the disease,20, 21 but this is the case only in
the presence of plaque20 and is related to the
number of cigarettes smoked per day.21 However,
in recent years, smoking has been evaluated as a
risk factor for periodontal disease together with
other subject-related risk factors and in that context does not seem to have a stronger impact than
factors such as cardiovascular disease or obesity.7
Thus, among the patients involved in our
study, smoking seemed to be overestimated
almost to the level of poor oral hygiene/bacteria.
However, only a few patients cited other subject-related risk factors. Genetics/inheritance had
a slightly higher percentage (17.5%) compared
with systemic disease (14.5%) and stress (4.5%).
Linden et al. reported that occupational stress has
a relationship to the progression of periodontitis.22
Peruzzo et al. reviewed the relationship between
psychological factors and periodontal disease and
62 Volume 2 | Issue 2/2016

concluded that there is a positive relationship
between stress and periodontal disease.23 Studies
have shown a correlation between poorly controlled diabetes and speciﬁc gene polymorphisms
and periodontal disease.24 Our results on the
knowledge of causes of periodontal disease
among patients referred to the specialist periodontal clinic are in agreement with a similar
study by Razzak et al.25 and point to the need to
improve patients’ knowledge about periodontal
disease and its risk factors. In our study, the
majority of the patients (70.1%) were informed by
dental professionals.

Conclusion
Within the limitations of this study, we conclude
that the rate of knowledge about periodontal disease among the patients referred to the specialist
periodontal clinic was poor, since 40% of the referred patients had not received any information
about the disease. Patients suffering from periodontal disease require motivation in order to
comply with the treatment. Therefore, in order to
treat or control periodontal disease effectively,
programs that focus on improving both the dental professionals’ and the patients’ knowledge
about periodontal risk factors and on motivation
techniques among general dentists and dental
hygienists should be implemented.
Competing interests
The authors declare that they have no competing
interests related to this study. This project was
self-ﬁnanced by the Department of Periodontology at Södra Älvsborg Hospital, Borås, Sweden.

Journal of
Oral Science & Rehabilitation

[63] => JOSR_2_A4.qxp_Layout 1

Knowledge about periodontal disease among patients referred to a specialist clinic

References
1.
Löe H, Theilade E, Jensen SB.
Experimental gingivitis in man.
→ J Periodontol.
1965 May-Jun;36(3):177–87.
2.
Theilade E, Wright WH, Jensen SB, Löe H.
Experimental gingivitis in man. II.
A longitudinal clinical and bacteriological
investigation.
→ J Periodontal Res.
1966 Feb;1(1):1–13.
3.
Lindhe J, Hamp SE, Löe H. Plaque induced
periodontal disease in beagle dogs.
A 4-year clinical, roentgenographical
and histometrical study.
→ J Periodontal Res.
1975 Oct;10(5):243–55.
4.
Borrell LN, Papapanou PN. Analytical
epidemiology of periodontitis.
→ J Clin Periodontol.
2005 Oct;32 Suppl 6:132–58.
5.
Renvert S, Ohlsson O, Persson S, Lang NP,
Persson GR. Analysis of periodontal risk
proﬁles in adults with or without a history
of myocardial infarction.
→ J Clin Periodontol.
2004 Jan;31(1):19–24.
6.
Norderyd O, Hugoson A, Grusovin G. Risk
of severe periodontal disease in a Swedish
adult population: a longitudinal study.
→ J Clin Periodontol.
1999 Sep;26(9):608–15.
7.
D’Aiuto F, Nibali L, Parkar M, Patel K,
Suvan J, Donos N. Oxidative stress,
systemic inﬂammation, and severe
periodontitis.
→ J Dent Res.
2010 Nov;89(11):1241–6.

8.
Nibali L, D’Aiuto F, Griffiths G, Patel K,
Suvan J, Tonetti MS. Severe periodontitis
is associated with systemic inﬂammation
and a dysmetabolic status: a case–control
study.
→ J Clin Periodontol.
2007 Nov;34(11):931–7.
9.
Deinzer R, Micheelis W, Granrath N,
Hoffmann T. More to learn about:
periodontitis-related knowledge and
its relationship with periodontal health
behaviour.
→ J Clin Periodontol.
2009 Sep;36(9):756–64.
10.
Horne R, Barber N, Elliott R, Morgan M.
Concordance, adherence and compliance
in medicine taking: Report for the National
Co-ordinating Centre for NHS Service
Delivery and Organisation R & D
(NCCSDO) [Internet]. London: National
Coordinating Centre for Service Delivery
and Organisation;
2005 Dec [cited 2016 Mar 9]. 309 p.
→ Available from: http://www.netscc.ac.
uk/hsdr/ﬁles/project/SDO_FR_08-1412076_V01.pdf.
11.
Blinkhorn AS. Factors affecting the compliance of patients with preventive dental
regimens.
→ Int Dent J.
1993 Jun;43(3 Suppl 1):294–8.
12.
Jönsson B, Öhrn K, Lindberg P, Oscarson
N. Cost-effectiveness of an individually
tailored oral health educational
programme based on cognitive
behavioural strategies in non-surgical
periodontal treatment.
→ J Clin Periodontol.
2012 Jul;39(7):659–65.

13.
Mårtensson C, Söderfeldt B, Axtelius B,
Andersson P. Knowledge of periodontitis
and self-perceived oral health: a survey
of periodontal specialist patients.
→ Swed Dent J.
2013;37(1):49–58.
14.
Pralhad S, Thomas B. Periodontal
awareness in different healthcare
professionals: a questionnaire survey.
→ J Educ Ethics Dent.
2001 Jul;1(2):64–67.
15.
Furuta M, Ekuni D, Irie K, Azuma T,
Tomofuji T, Ogura T, Morita M. Sex
differences in gingivitis relate to
interaction of oral health behaviors
in young people.
→ J Periodontol.
2011 Apr;82(4):558–65.
16.
Gift HC. Awareness and assessment
of periodontal problems among dentists
and the public.
→ Int Dent J.
1988 Sep;38(3):147–53.
17.
Jönsson B, Öhrn K, Lindberg P, Oscarson
N. Evaluation of an individually tailored
oral health educational programme
on periodontal health.
→ J Clin Periodontol.
2010 Oct;37(10):912–9.
18.
Croxson LJ. Periodontal awareness:
the key to periodontal health.
→ Int Dent J.
1993 Apr;43(2 Suppl 1):167–77.

20.
Ismail AI, Burt BA, Eklund SA.
Epidemiologic patterns of smoking and
periodontal disease in the United States.
→ J Am Dent Assoc.
1983 May;106(5):617–21.
21.
Amarasena N, Ekanayaka AN, Herath L,
Miyazaki H. Tobacco use and oral hygiene
as risk indicators for periodontitis.
→ Community Dent Oral Epidemiol.
2002 Apr;30(2):115–23.
22.
Linden GJ, Mullally BH, Freeman R. Stress
and the progression of periodontal disease.
→ J Clin Periodontol.
1996 Jul;23(7):675–80.
23.
Peruzzo DC, Benatti BB, Ambrosano GM,
Nogueira-Filho GR, Sallum EA, Casati MZ,
Nociti FH Jr. A systematic review of stress
and psychological factors as possible risk
factors for periodontal disease.
→ J Periodontol.
2007 Aug;78(8):1491–504.
24.
Lalla E, Kaplan S, Chang SM, Roth GA,
Celenti R, Hinckley K, Greenberg E,
Papapanou PN. Periodontal infection
proﬁles in type 1 diabetes.
→ J Clin Periodontol.
2006 Dec;33(12):855–62.
25.
Razzak A, Aslam M, Malik S. Patient’s
awareness about the risk of factors
and the prevention of dental disease.
→ Pak Oral Dent J.
2012 Aug;32(2):300–3.

19.
Gao X, Lo EC, Kot SC, Chan KC.
Motivational interviewing in improving
oral health: a systematic review
of randomized controlled trials.
→ J Periodontol.
2014 Mar;85(3):426–37.

Journal of
Oral Science & Rehabilitation

Volume 2 | Issue 2/2016 63

[64] => JOSR_2_A4.qxp_Layout 1

Guidelines for authors

Authors must adhere
to the following guidelines

Informed consent

Title

Patients have a right to privacy that should not be violated without informed consent.
Identifying information, including patients’ names, initials or hospital numbers, should
not be provided in the manuscript or visual material unless the information is essential
for scientiﬁc purposes and the patient (or parent or guardian) has given written informed
consent for publication. Informed consent for this purpose requires that an identifiable
patient be shown the manuscript to be published. Authors should disclose to these
patients whether any potential identifiable material might be available via the Internet
as well as in print after publication. Nonessential identifying details should be omitted.
Informed consent should be obtained if there is any doubt that anonymity can be maintained. For example, masking the eye region in photographs of patients is inadequate
protection of anonymity. If identifying characteristics are altered to protect anonymity,
authors should provide assurance that alterations do not distort scientiﬁc meaning.
When informed consent has been obtained, it should be indicated in the manuscript.

The title should not exceed 35 characters. Capitalize
only the ﬁrst word and proper nouns in the title. Please
include a running title as well.
Author information

The following information must be included for each
author:
– Full author name(s)
– Full afﬁliation (department, faculty, institution,
town, country).
For the corresponding author, the following information should be included in addition:

Human and animal rights
– Full mailing address
When reporting experiments on human subjects, authors should indicate whether the – Email address.
procedures followed were in accordance with the ethical standards of the responsible
Abstract and keywords
committee on human experimentation (institutional and national) and with the Declaration of Helsinki of 1975, as revised in 2013 (www.wma.net/en/30publications/ 10policies/b3/index.html). If doubt exists whether the research was conducted in accordance The manuscript must contain an abstract and a maxwith the Declaration of Helsinki, the authors must explain the rationale for their ap- imum of ﬁve keywords. The abstract should be selfproach, and demonstrate that the institutional review body explicitly approved the contained, not cite any other work and not exceed 250
doubtful aspects of the study. When reporting experiments on animals, authors should words. It should be structured into the following
indicate whether institutional and national standards for the care and use of laboratory separate sections: objective, materials and methods,
animals were followed. Further guidance on animal research ethics is available from the results, conclusion, and keywords.
International Association of Veterinary Editors’ Consensus Author Guidelines on Animal
Structure of the main text
Ethics and Welfare (www.veteditors.org/consensus-author-guidelines-onanimalethics-and-welfare-for-editors).
The body of the manuscript must be structured
as follows:

Preparing the manuscript text

– Introduction (no subheadings)
– Materials and methods
– Results
General
– Discussion
The manuscript must be written in U.S. English. The – Conclusion.
main body of the text, excluding the title page, abstract and list of captions, but including the referCompeting interests
ences, may be a maximum of 4,000 words. Exceptions may be allowed with prior approval from the Authors are required to declare any competing ﬁnancial
publisher.
or other interests regarding the article submitted. Such
competing interests are to be stated at the end of manAuthors will have the opportunity to add more infor- uscript before the references. If no competing interests
mation regarding their article, as well as post videos, are declared, the following will be stated: “The authors
present a webinar and blog on the DT Science web- declare that they have no competing interests.”
site.
Acknowledgments

It is preferred that there be no more than six authors.
If more authors have participated in the study, the Acknowledgments (if any) should be brief and incontribution of each author must be disclosed at the cluded at the end of the manuscript before the referend of the document.
ences, and may include supporting grants.

64 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

[65] => JOSR_2_A4.qxp_Layout 1

Guidelines for authors

References

Requirements for tables

Authors are responsible for ensuring that the information for each reference is complete and accurate.
All references must be cited within the manuscript.
References appearing in the list but not in the manuscript will be removed. In-text citation should follow
the citation–sequence format (e.g., “as discussed by
Haywood et al.15”) using superscript numbers placed
after the punctuation in the relevant sentence. The
references must be numbered consecutively.

Each table should be supplied separately and in Microsoft Word format. Tables may not be embedded as
images and no shading or color is to be used.

Tables should be cited consecutively in the manuscript. Place the references to the tables in your article
wherever they are appropriate, whether in the middle
or at the end of a sentence. Every table must have a
descriptive caption, and if numerical measurements
are given the units should be included in the column
The reference list must be numbered and the refer- headings.
ences provided in order of appearance. For the reference list, the journal follows the citation style stipuSupplements/supporting material
lated in Citing medicine: the NLM style guide for authors, editors, and publishers. The guidelines may be DT Science allows an unlimited amount of supportviewed and downloaded free of charge at
ing material (such as datasets, videos or other additional information) to be uploaded. This material
www.ncbi.nlm.nih.gov/books/NBK7256/
should be presented succinctly (in English). The auThe reference list may not exceed 50 references.
thor bears full responsibility for the content. Color,
animated multimedia presentations, videos and so
on are welcome and published at no additional cost
List of captions
to the author or reader. Please refer briefly to such
Please provide the captions for all visual material at material in the manuscript where appropriate (e.g.,
as an endnote).
the end of the manuscript.
Abbreviations

Abbreviations should be used sparingly and deﬁned
when ﬁrst used. The abstract and the main manuscript text should be regarded as separate documents
in this regard.
Typography

– Use Times New Roman regular with a font size of 12 pt.
– Use double line spacing with blank lines separating sections and paragraphs.
– Type the text unjustiﬁed and do not apply
hyphenation at line breaks.
– Number all of the pages.
– Use endnotes if necessary, but not footnotes.
– Greek and other special characters may be
included.

Preparing the visual material

Submit your research and
clinical articles to
Dr. Daniele Botticelli at
daniele.botticelli@gmail.com

Requirements for images

Each image should be supplied separately and the following formats are accepted: PSD, TIFF, GIF and
JPEG. The image must have a resolution of 300 dpi
and must be no smaller than 6 cm × 6 cm.
Please number the images consecutively throughout
the article by using a new number for each image. If it
is imperative that certain images be grouped together,
then use lowercase letters to designate these in a
group (e.g., “Figs. 2a–c”).
Place the references to the images in your article
wherever they are appropriate, whether in the middle
or at the end of a sentence. Provide a caption for each
image at the end of your article.

Journal of
Oral Science & Rehabilitation

For all other requests,
contact
Nathalie Schüller at
n.schueller@dental-tribune.com
T +49 341 4847 4136
Dental Tribune International Publishing Group
Holbeinstr. 29
04229 Leipzig
Germany
www.dtscience.com
www.dental-tribune.com

Volume 2 | Issue 2/2016

65

[66] => JOSR_2_A4.qxp_Layout 1

Imprint: About the publisher

Publishing team

Editorial board

Publisher

Editor-in-Chief

Torsten R. Oemus
t.oemus@dental-tribune.com

Ugo Covani, Pisa and Camaiore, Italy
Co-editors

Managing Editor
Nathalie Schüller
n.schueller@dental-tribune.com

Daniele Botticelli, Rimini, Italy
José Luis Calvo Guirado, Murcia, Spain
Miguel Peñarrocha Diago, Valencia, Spain

International office

Concept & design

Associate editors

Dental Tribune International
Holbeinstr. 29
04229 Leipzig
Germany

Rhowerk
www.rhowerk.com

Antonio Barone, Pisa, Italy
Luigi Canullo, Rome, Italy
Rafael Arcesio Delgado Ruiz, Stony Brook, N.Y., U.S.
David Peñarrocha Oltra, Valencia, Spain

T +49 341 4847 4302
F +49 341 4847 4173
info@dental-tribune.com
www.dental-tribune.com

Digital Manager
Serban Veres
serbanveres@gmail.com
Copy editors

Scientific advisers
Pablo Galindo Moreno, Granada, Spain
Georgios Romanos, Stony Brook, N.Y., U.S.
Giovanni Serino, Borås, Sweden

Sabrina Raaff
sabrina@greenbadger.co.za

Statistical advisers

Hans Motschmann
h.motschmann@oemus-media.de

Marco Tallarico, Sassari, Italy
Francesco Tessarolo, Mattarello, Italy
Executive board

International administration
Chief Financial Officer

Daniele Botticelli, Rimini, Italy
Luigi Canullo, Rome, Italy
Torsten R. Oemus, Leipzig, Germany

Dan Wunderlich
d.wunderlich@dental-tribune.com

Board of reviewers

Executive Producer
Gernot Meyer
g.meyer@dental-tribune.com

Copyright regulations
The Journal of Oral Science & Rehabilitation is published quarterly by Dental Tribune International (DTI).
The journal and all articles and illustrations contained therein are protected by copyright. Any utilization
without the prior consent of the authors, editor and publisher is prohibited and liable to prosecution.
This applies in particular to the duplication of copies, translations, microﬁlms, and storage and processing
in electronic systems. Reproductions, including extracts, may only be made with the permission of the
publisher. Given no statement to the contrary, any submissions to the editorial department are understood
to be in agreement with full or partial publishing of said submission. The editorial department reserves
the right to check all submitted articles for formal errors and factual authority, and to make amendments
if necessary. Articles bearing symbols other than that of the editorial department, or that are distinguished
by the name of the author, represent the opinion of the afore-mentioned, and do not have to comply
with the views of DTI. Responsibility for such articles shall be borne by the author. Responsibility for advertisements and other specially labeled items shall not be borne by the editorial department. Likewise,
no responsibility shall be assumed for information published about associations, companies and commercial markets. All cases of consequential liability arising from inaccurate or faulty representation are
excluded. The legal domicile is Leipzig, Germany.
Printer
Löhnert Druck | Handelsstr. 12 | 04420 Markranstädt | Germany

66 Volume 2 | Issue 2/2016

Journal of
Oral Science & Rehabilitation

Marcus Abboud, Stony Brook, N.Y., U.S.
Marco Álvarez, Mexico City, Mexico
Conrado Aparicio, Minneapolis, Minn., U.S.
Shunsuke Baba, Osaka, Japan
Franco Bengazi, Brescia, Italy
Andrea Edoardo Bianchi, Milan, Italy
Manuel Bravo Pérez, Granada, Spain
Eriberto Bressan, Padua, Italy
Marco Caneva, Trieste, Italy
Juan Carlos De Vicente Rodríguez, Oviedo, Spain
Stefan Fickl, Würzburg, Germany
Joseph Fiorellini, Philadelphia, Pa., U.S.
Abel García García, Santiago de Compostela, Spain
Gerardo Gómez Moreno, Granada, Spain
Federico Hernández Alfaro, Barcelona, Spain
Carlos Larrucea Verdugo, Talca, Chile
Baek-Soo Lee, Seoul, South Korea
Dehua Li, Xi’an, China
Aleksa Markovic, Belgrade, Serbia
José Eduardo Maté Sánchez de Val, Murcia, Spain
Alberto Monje, Ann Arbor, Mich., U.S.
Yasushi Nakajima, Osaka, Japan
Ulf Nannmark, Gothenburg, Sweden
Wilson Roberto Poi, Araçatuba, Brazil
Alessandro Quaranta, Dunedin, New Zealand
Maria Piedad Ramírez Fernández, Murcia, Spain
Idelmo Rangel García, Araçatuba, Brazil
Fabio Rossi, Bologna, Italy
Hector Sarmiento, Philadelphia, Pa., U.S.
Nikola Saulacic, Bern, Switzerland
Alessandro Scala, Pesaro, Italy
Carlos Alberto Serrano Méndez, Bogotá, Colombia
Andrew Tawse-Smith, Dunedin, New Zealand
Cemal Ucer, Manchester, U.K.
Joaquín Urbizo Velez, La Habana, Cuba

[67] => JOSR_2_A4.qxp_Layout 1

€50/issue of the Journal
(4 issues/year; including
VAT and shipping costs,
for a total of €200/year)
Your subscription will be
renewed automatically
every year until a written
cancellation is sent
six weeks prior to the
renewal date to
Dental Tribune
International GmbH,
Holbeinstr. 29, 04229
Leipzig, Germany.

Subscribe Now!
Shipping address

City

Country

Phone

Fax

Signature

Date

PayPal | subscriptions@dental-tribune.com

Credit card
Credit card number

Expiration date

fax: +49 341 4847 4173 | email: subscriptions@dental-tribune.com

Security code

[68] => JOSR_2_A4.qxp_Layout 1

Nobel Biocare Global Symposium
June 23–26, 2016 – New York

Where innovation comes to life

Register
now

nobelbiocare.com/global-symposium-2016

An experience beyond the ordinary

Design your own learning experience

The Nobel Biocare Global Symposium 2016 program will
QHHGTWPRCTCNNGNGFENKPKECNCPFUEKGPVKƂEGFWECVKQPCUYGNN
as in-depth hands-on training. Held at the Waldorf Astoria
KP0GY;QTMKVoUCWPKSWGQRRQTVWPKV[VQGZRGTKGPEGJQY
innovation can come to life in your daily work.

%JQQUGHTQOPWOGTQWUNGEVWTGUHQTWOUOCUVGTENCUUGU
and hands-on sessions – from over 150 of the best speakers
and presenters in the world. This must-attend event will
EQXGTCXCUVXCTKGV[QHVGEJPKSWGUCPFVTGCVOGPVUQNWVKQPU
HTQOFKCIPQUKUVQVTGCVOGPVEQORNGVKQP&QPoVOKUUVJKU
QRRQTVWPKV[5KIPWRPQYCPFYGoNNUGG[QWKP0GY;QTM

Read more about the Symposium
© Nobel Biocare Services AG, 2016. All rights reserved. Nobel Biocare, the Nobel Biocare logotype and all other trademarks are, if nothing else is stated or is evident from the context in a certain case, trademarks of Nobel Biocare. Please refer to nobelbiocare.com/trademarks for more information. Product images are not necessarily to scale. Disclaimer: Some products may not be regulatory cleared/released for
UCNGKPCNNOCTMGVU2NGCUGEQPVCEVVJGNQECN0QDGN$KQECTGUCNGUQHƂEGHQTEWTTGPVRTQFWEVCUUQTVOGPVCPFCXCKNCDKNKV[

) [page_count] => 68 [pdf_ping_data] => Array ( [page_count] => 68 [format] => PDF [width] => 612 [height] => 859 [colorspace] => COLORSPACE_UNDEFINED ) [linked_companies] => Array ( [ids] => Array ( ) ) [cover_url] => [cover_three] =>

[cover] =>

[toc] => Array ( [0] => Array ( [title] => Cover [page] => 01 ) [1] => Array ( [title] => Editorial [page] => 03 ) [2] => Array ( [title] => Contents [page] => 04 ) [3] => Array ( [title] => About the Journal of Oral Science & Rehabilitation [page] => 06 ) [4] => Array ( [title] => Benefits of publishing in the journal for authors [page] => 07 ) [5] => Array ( [title] => The role of melatonin in periodontal and periimplant bone homeostasis and regeneration [page] => 08 ) [6] => Array ( [title] => Three-year clinical and radiographic outcomes of patients treated according to the All-on-4 concept in the daily practice: A prospective observational study on implants and prosthesis survival rates and complications [page] => 16 ) [7] => Array ( [title] => Accelerated generation of human induced pluripotent stem cells from human oral mucosa using episomal plasmid vectors and maternal transcription factor Glis1 [page] => 26 ) [8] => Array ( [title] => Bone block graft to treat an apicomarginal defect simultaneously with apical surgery of the maxillary incisors: A case report with three-year follow-up [page] => 36 ) [9] => Array ( [title] => Composition of platelet-rich plasma gel: A Western blot analysis [page] => 42 ) [10] => Array ( [title] => Spontaneous bone regeneration after removal of cysts: One-year follow-up of 336 consecutive cases [page] => 50 ) [11] => Array ( [title] => Knowledge about risk factors associated with periodontal disease among patients referred to a specialist periodontal clinic [page] => 58 ) [12] => Array ( [title] => Guidelines for authors [page] => 64 ) [13] => Array ( [title] => Imprint [page] => 66 ) [14] => Array ( [title] => Subscription form [page] => 67 ) ) [toc_html] =>

Table of contents

[toc_titles] =>

[cached] => true )